GenePrediction:GLEAN_4354 Details

Name: GLEAN_4354
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:448506..447948 (- strand)
Length: 559
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:448506..448351 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_179:447992..447948 (- strand)
Length: 45
>GLEAN_4354 class=GenePrediction position=GCSC_179:448506..447948 (- strand)
ATGACCACGCTGGAGCTCACGGCGCTGTCATTTTCCTTGACCATGATCGCCACTGCTCTCTGCTGGTTTCCTAAACCCCA
GATCAATGCACCTTTGACGATCCGCACTAATAACGACCGAGCGGTAGAGGAGATACGAAAGATTGCTCGAGAAACGGTAA
GGATGTTATCCTTTCCTTTCTTTTCTAGTTATTTCATTACGTAAGATACTAACTCCATATTCAATCGGCGTATCAAGACT
CATCCTGGCTTACCTATTAAGTGGTATCGTACCCCTCTTGATTTCATTTCCCGACGAGAGTTTGTTGCGGATACACATTG
GACCTTGTTCTCTAGCCTGAGCCACATGGTCCATTTTCCTATTTTTTCCAGGCCTATGCGAATGAGACCTTGGGACAAAT
TTCCAGATGACGAGTGGAAACCGATCGACTATGCATCCTTGCCAGTCGGCTCTATTGTGCTCCTTGGCGTAAGCTTGTCT
TTTGTTTGCGCTTGGAACTTCCACTTTCCAACAGAAGTCGAGAAGACATTATGGCACGTCGCCAGCTGCTGTCACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62