GenePrediction:GLEAN_4357 Details

Name: GLEAN_4357
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:440362..438038 (- strand)
Length: 2325
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:440362..439902 (- strand)
Length: 461
Type: CDS
Source: GLEAN
Position: GCSC_179:439749..439004 (- strand)
Length: 746
Type: CDS
Source: GLEAN
Position: GCSC_179:438645..438038 (- strand)
Length: 608
>GLEAN_4357 class=GenePrediction position=GCSC_179:440362..438038 (- strand)
ATGATTGTTCGCATCTTTGCCAGTGCCGGGCTTCAATGCTCTCTCTGCTTCTCATTCTTCGACTCTTCTCTTCTCTGGCG
AGAATCGCGCAATATAGCTGTTGAAATGGAATATCAGTTACTTTCTCCGTCGCTTCGTTGTTCCCAGAACATCGCTCTTC
TCTCAATACTCCCCACCTTCCGCTCTCAAGCAACTGAAGAGGCACTACGCCCCGACTTATCCATCTCTTCCAAATCCGAT
GATTCGCTTGTTCAGGTCCTAGCCTACCTGGCGGCTATCGATGTTGATCCCAAACACGTTACCGCCGTCGCTGTGGAAGG
TGCTGCTGAAGCATTCTCCTTGCTGCATGTACACGTTGCCATCAATAAGGCCCGTCCTGGCGACGGTCATGCCGTGCTGG
AGCGCATAGTTGCCAGCTTTCAGCGATTGTTTTTGATCATGGTCGTCAATCGTTCTGGCACGTATAGATACCAGCCGGTG
ATATGTCTTGGCACTCATACGCTGCTCCAACAATAACCACCCCTCTAGTACCTAGAATCGTGCTGAGAAACCGGCTTCTT
TGCGAAGCTGTCGAACTTTGTCGTGGCAGAATTTTTCACTTTCTCGGTCTCAGATACAAACCGCCTGCTAACAAGAGGTG
TTGTTCGTTTCTTGGCGGGCAACTACAAGAGTTTGTGGACGCGCTACAGAAGCTAGCAAGGCCGGCCAAACAGCCAGACC
CGGATCTGCAGGAGTTTCTTGCCCGTTCTGTCGAGCTTATCACAGAACTTGATCCACTACGTCCGGCCATATTCACAGCC
GATGCGACACACCCTGACTCAGCCAGTTTGGTCCGCGTCGTCTATTCTGTATATCTCTACAGTAAAGTTCTGGGCGATCG
TCTCGGTGGAGTCCTTGACCGGCTAACAGGACGTCATATCAATCTGACCGTGCGTGACGTCCTGAAGCGACGTCTCCATG
GACTCGCCTGTTTCGTCCGATGTGCCCATTTTCTGTGCCGGCTCGCATTAAACGAGACGCCACCATGGCTGGGCAACGTC
GAGGTTGTTCCTGTGCAGCTGACGGCCGCCAATTTTGTCTCTCTGAAACTAGCATCGGCATCGGCTGCAGCAACGGCGGT
CTCTCAGACACCATCCCCGCCGTCTCTCGACGCCTGCCTTGCTCAGTGGAACTGGACCGCTGCCAGGCTTGAAATGACCC
TCCGCAAGCGCAACTACAGCATTCCCTCTCCTCGACTCCAGTTCACCACCACTTGCAATCAACTTTACGGATCCACACCC
AATAAGCCCAAGATCCACGCAGAAATCCAAATCGCCTATCACTTGGACAGTCAAAACAAGGACAGGCGGGATGTTCCTCG
TCTGCTTATCTGTGCCTCAAAGAGCCCCTGCTACCTATGTCATGCCTTCCTTACTGGTCATGGTGGATACATGGTGCCTC
CAACGCATGGGCAGCTGTATCCTGGCTGGCGGTTACCATATGGCGACGATGGAACTGAAAAACGAAACAATAACGAAACC
GGAAGAGAGCACAAATTATTGGCAGAATCTTTCGCCGTTTCCTTGGACCGGCTCAATACTGCTTTAGAGGACGACATAAG
TTCAAGGCTCGCGTCTTTGACCAGGCCTGGTGTCCAGCTCAGCAGAGAGGTAACCTTCATTGAGAGCCCCTTTTTTTAAA
ATGCCACCGTCTGAGACTTCTCTGGCTGTGACGTCAGCTTCAGACATGGCCTCGCTTGTTGAGGCAGAGGACGTGAAGGG
AAAGGATGATGCGAATAATGAGCCAGTTGCATCTCAGATCTTCCTTGGGGGCACTGAACCGACCCCCCCAACGACCCCCC
CAACATCGGCCTTATTTCACGCGCGATCATTAGCGGGTCATATTGAGTCAGGAAGCCAGGACAAGGCCGATAGTGGTAGT
GATAGCGACGCCACTGTTCAGCAAATTGCGGTTGGGCATGGCCAGGAAGGGCACAATGATACGCCCTACGACGTCGTCTT
CCACTCTACAGGCAGCCGGCCAACTGGGGCTCGTCGCTACGCTACGAACGAACTGGAGCTTTTCATTACGTTTGGCAGCG
AGGATGGGGGAGTGCGCGATCCAGCCGTACCACAATCCAGCGTTCGGGCGCGCAAGCTGCCCGTCGACGAGGCAGCTTCG
TATGCCGTCCACGCCGTCGATGTGAGCGGCCTTGCATGTGGCAGTGAGGTGCCGGCCATTCCTATTGGCACTGACGGACG
TTTGCATCTGCGTGCCGGCAGTGATATCTACGAAGTGTTGATATCGACTGGAGAGGCGAGACAGCCTGCACATGCGAACG
TATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62