GenePrediction:GLEAN_4358 Details

Name: GLEAN_4358
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:433302..430608 (- strand)
Length: 2695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:433302..433237 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_179:433174..432926 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_179:432876..430771 (- strand)
Length: 2106
Type: CDS
Source: GLEAN
Position: GCSC_179:430694..430608 (- strand)
Length: 87
>GLEAN_4358 class=GenePrediction position=GCSC_179:433302..430608 (- strand)
ATGGCGCAAGTGCTTCTCAATTACAAGAGGCCGGTGGACTACAATGCCCAGCTGAGTAGGGATCCCGTATGCGAGGCGGT
AGTGGATGGTCTGGGCCGAGCTAACTTCGGGCTGCAGCTGCTTTTAAGAGCTTTCTGTCGGACTTCAAGTCGACGCCGGA
ACACGCCATAGTCCATGCTCTGGGCAACATCAACATTGACGATGACGACCTGAGCGACGAGTACGACTTCATGGACGAGG
ACGGCGGCGCGGCGGCGCGGCGGGCACAAGAGCGGGCAGCACGACGCAAGCCGCAGTACAAGTACCGGGAGCTGCTGCAG
GGACTGGCGGACCGGAAGATCAACGAGATTGTGGTGGACCTGGACGACGTGCATTCAGTAGGTGGTGTTGTGTATGTTGT
GTTGGCCATAGTTACTGACAAATCAGTTCGAAGAGGACGTGGGCCAGGAGCTCAAGCTGACGCAGTCGATCGAGGGTAAC
ACGAAGCACTACGTGGAGCTGCTGTCGAAAGCGGTGGATGAGTTGCTGCCAGAGCCGAGCACAGACGTGTCGTTCAAAGA
TGACGTACTGGACGTGCTGATGGCGCGGCGCAAGCTGCGCAATCGCGAGCTACAGGACGGGGCGGAGGCGCTGGGCGATC
CGGCGATGCTGACGGACATGTTCCCGGCAGAGCTGACGCGACGGTACACGCTGGTGTTCCGGCCGCGGACGTCGACAATG
GAGCACGTGGCAAAGCCACTGGCAGTGCGACAGGTGCGCGGCGAGGATCTGGGACACCTGATTACGATCCGGGCGATTGC
GACGCGGGTGTCGGACGTGAAACCGATTGCGCAGGTGAGCGCATACACGTGCGACCGGTGCGGCTGCGAGATCTTCCAGC
CGGTGACGGACAAGCAGTTTGCGCCGCTAGCGATCTGCCCGTCGGCCGACTGCAAGGCGAACCAGTCGGGCGGACAGTTG
CACCCGTCATCGCGGGCGTCCAAGTTTCTGCCGTTCCAAGAGGTCAAGGTGCAGGAGCTGGCAGAACAGGTGCCGATCGG
GCAGATTCCGCGCACACTGACGGTGCTGTGCTACGGCAGTCTGGTGCGGCGGATCAGCCCGGGCGACGTGGTGGACATTG
CGGGCATCTTCTTGCCGACACCGTACACGGGCTTCAAGGCGATGCGGGCGGGCTTGCTGACGGACACATACCTGGAGGCG
CACCACGTGGCGCAGCACAAGCGGGCGTATGAGGACATGCAGATCGAGCCACAGCTGGTGCGGCGGATCGAGCAGTTCCG
GCAGTCGGGACACGTGTACGAGTACCTGGCCAAGTCGATCGCGCCAGAGATCTTTGGGCACCTGGACGTGAAGAAGGCGC
TGCTTCTGCTGCTGGTGGGCGGAGTGACGAAGCAGATGGGTGACGGGATGAAGATCCGCGGCGACATCAACATCTGTCTG
ATGGGCGACCCGGGTGTGGCCAAGTCGCAGCTGCTCAAGTACATCAGCAAGGTGGCGCCGCGCGGCGTATACACAACGGG
ACGAGGCAGCAGCGGTGTAGGTCTGACGGCGGCGGTGATGCGCGACCCGGTGACGGACGAGATGGTGCTGGAGGGTGGGG
CGCTGGTGCTGGCGGACAACGGGATCTGCTGCATCGACGAGTTTGACAAGATGGACGAGAACGACCGGACAGCGATCCAC
GAGGTGATGGAGCAGCAGACGATCAGCATCAGCAAGGCGGGCATCTCGACGTCGCTGAACGCGCGCACATCGATCCTGGC
GGCGGCGAACCCGATCTACGGCCGGTACAACCCGCGGATCTCGCCGGTCGAGAACATTAACCTGCCGGCAGCGCTGCTGT
CGCGGTTTGACGTCATGTTCCTGCTGCTGGACACGCCGTCGCGCGAGACGGACGGACAGCTGGCGAAGCACGTGACCTAT
GTGCACATGCACGGGCGGCATCCGACGATTGGGGAGAGCAGTGACGCGGATGCGGACGTGGTCTTCTCGCCGCACGAGGT
GCGGTCATACGTGGCGCGCGCGCGGACGTTCCGGCCGGTGGTGCCGGAGTCAGTGTCGGACTACATGGTCAAAACGTACG
TGCGGATGCGCGAGCAGCAGAAGCGGGCGGAGAAGCGCGGGCGCCAATTCACGCACACAACGCCGCGCACGCTGCTGGGC
ATCGTGCGGCTGGCTCAGGCGCTGGCGCGGCTGCGGTTCTGCGACGCCGTCGACCGGTACGACGTGGACGAGGCCCTGCG
TCTGATGGAGGCCAGCATGGAGACGCTCAATGCGGAGAGCACAAACAGCGGTGGCGGCCGTCGGGGCAACGCCAGCAGCC
GCATCTACAGCTTTGTCAAGTCGCTGGCGGACTCGGGCGCCTGCCGGCCCGACCGGGAGGAGGACGGGGCGGACGCGGAC
GAGGACGAGGAAGACAACCACAACAGCGGCGGCATCGAGCTGAGCCTGCGTCGCGTCAAGGAGCGGGTCATTGCCAAGGG
CTTCACGGAGGACCAATGGCTGACGGCGCTGGACGAATACGCCGCGATCGATGTGAGTAGGAGAGGAAGGAGAGAGGAGA
GAGGAGAGAGAGAGAAGAAATTTTTTGCGATCCTTGCTAACTCTATAGGTCTGGCAAACGGCTGGAAACATGAGCAGACT
GGTGTTCATCGCGTCGGCCGAGGACGGCGAGGCAGACGACGACGACGACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62