GenePrediction:GLEAN_435 Details

Name: GLEAN_435
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1740553..1744067 (+ strand)
Length: 3515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1740553..1743542 (+ strand)
Length: 2990
Type: CDS
Source: GLEAN
Position: GCSC_167:1743593..1744067 (+ strand)
Length: 475
>GLEAN_435 class=GenePrediction position=GCSC_167:1740553..1744067 (+ strand)
ATGAGCGAATTCCAGGCGCCGAAATTTGGTGGCAGGCCCGCTGAGAGCGCAACAGACTTTCTGCGTCGTCTCAACGTCAA
GTGCTTGACAATCGGCTGCAAGTCCGAGAGCGACAAGGATGATTTTCGGCTCGTGTATTTTGTCGACGGCCTCCGAGATG
GGGCTAGAGCTTGGTACGATGACGAGCTGTCAGCAGCAGAGCGCGAGTCGTGGCCGCTGCTGGCTAAGGCGTTCTGCGAG
CGCTGGGGTGGTCGCAGCGAGGATGACGGCCAGAGGGACGAGGGGACCGAGAGAGTTGGAGCTGCAGGCGAACTGATTGG
TGACGGCGTCGACACGGTCGTTCCCCACTACGACGACGACGACGACGACGCTGCGGTGACGGCCATTATTGCAGCCGGCA
CAACACAATCCCCGACGGCGGCTGAGCTGCCTCTCGAGGGCGGCATGCTGCTTCGAGATATGCCTCAACGGACGGCATTT
TACGACTCTATCGACGAGCGTCAGATGAGCCAGAGCGATGCCAAGCTGTTCTACCAGAGGAGCCAGCTAGACCTGCAGCA
GCTGAAGCAGCCGGCGCTGCAGTTTGATCCCGTCGGAAGTCCACTCGTCAGCGTGCCCACCGCCTCGTCTGTTGCTGACC
CAAGCCACGGCTTACCGCCATTGCCAAGCAGCGATTACGGCTTTGGCGAGGTGGATCTTGACGCAGCAGCAGCTGCTGTT
GGTGCTGCAGGTGGTACTTCGACTATGCCTGGCGAAAGTGGGCCTTCGAATCTGGGTGCTACGGCAGTAACAGCAGGCAT
GACAGCGACTGCTGCGGCGGTGACGCCGATCATGGCTCCATCAGCCACGATGATACCCACAGCAGCAGCCATGGCTTCGG
GGTCATTGGGTGGTGGCTTGAGCTCGCTCACAGGGCTGAGTATCGGTGAGCCGTCAGGGATCGGCAGCAGAACGTACGCC
GATGCGGATCCGCAGATCACGACGGAGCTGGCGGCGATCTTTGTGGACATCAAGAAGTTTATCGATCTGCGACGCAAGTA
CATCGGTCTCTCACTGCAGGGGCCGACGGACAATCCCAAGGACGACCCCAGCTGGAGGATCTACCCACCCCCACCAGATC
CGGCTTGGGTGGCCGAGCACGGCACCGGGACGCACGATGCCAGCAACGGGGCAGACAGCCTCGCTGCCAGCACGGTGCTG
CCGGAGCAGACGGGCGACGGCAGCCAGGCACAGGAGGCACAGCCGCGGCCTCCTGCACAGAACAAGAAGCGCAAGCCTGG
GCAGGACATCGGCGAGGACTTCAACATGGACGACCTGATGCCGCTGCCGGGCGAGAGCAAGATGGTGTACCGGCTGGACA
AGAACAGTGTGTACCAGGTGTACGAGGACGAGCAGGTGGCAGCGGCAGCGGCAGCGGCCGAAGAAGGAGCAGAGAGCAGC
GGCGCGGAGACAGGAATGACAGCGATGCCGATTGTGCAGGTGCCGACGCTGCGGGAGTTCTACATGGACCTGGAGCCGAT
CCTGGCGCTGTCTGCGGACGGGCCAGCCAAGAGCTTCGCGTACCGGCGGCTGCAGTACCTCGAGGGCAAGTTCGGACTGT
ACACGCTGCTGAACGAGTACCAAGAGACGGCAGATACGAAGCGGGTGCCGCACCGCGACTTTTACAACGTGCGCAAGGTG
GACACACACGTGCACCACTCGGCATGCATGAATCAGAAGCACCTGCTGCGGTTCATCAAGAGCAAGATGAAAAAGTGTCC
GGACGAGGTGGTGCTGTACCGCGACGGGCAGCTGCTGACACTGGCGCAAGTGTTTAAGAGCATCAAGCTGACGGCATACG
ACCTCAGCATCGACACGCTGGACATGCACGCCCACACGGACTCGTTCCACCGGTTCGACAAGTTCAACCTCAAGTACAAT
CCGGTTGGCGAGTCGCGGCTGCGGACCATCTTTCTCAAGACGGACAACGACATCCAGGGGCGGTATCTGGCCGAGATCAC
CAAGGAGGTGATTGCCGACATGGAGTCGAGCAAATACCAGATGGTGGAGTGGCGCATCTCGATCTACGGCCGGTCGGCGG
ACGAGTGGGAGAAGCTGGCGGCCTGGGTGGTGGACAACAAGCTGTTCTCGCACAACGTGCGCTGGCTGGTGCAGATCCCG
CGGCTGTTCGACGTGTACCGGGCGAGCGGGCTGATGGGACGGTTCGAGCAGGTCGTGGCCAACGTGTTTGAGCCGCTCTT
TGAGGCCACACGCAATCCGGCAGCGCATCCGAAGCTGCACGTCTTTCTGCAGCGGGTGATTGGGTTTGACAGCGTCGACG
ACGAGAGCAAGGTGGAGCGGCGGCTGTACAAGAAATTCCCGGTGCCGCGGGCATGGGACTCGCGCCAGAACCCGCCGTAC
AGCTACTGGATCTACTACATGTTTGCCAACATGGCGACGCTGAACGCGTTTCGACGACGGCGCGGCTTCAACACATTTGT
GCTGCGGCCGCACTGCGGCGAGGCTGGCGACAGCGAGCATCTGGCCGTGGCGGCGCTGTGTTCGCACAGCATCAGTCACG
GGCTGCTGCTGCGAAAGGTGCCGCTGCTGCAGTATGTCTTCTACCTGGAGCAGATCGGCATCGCTATGTCGCCGCTGAGC
AACAACGCGCTCTTTCTGGCGTACGAGCGCAATCCGTTCCACCAGTACTTCAAGCGCGGGCTCAACGTGTCTCTCTCGAC
CGACGACCCGCTGCAGTTTGCCTTTACCAAGGAGCCGCTGATCGAGGAGTACTCGGTGGCCGCACAGATCTACAAGCTCA
GCCCGGTCGACATGAGCGAGCTGGCTAAGAACTCGGTCCTCCAGAGCGGCTACGAGTTCGCCATCAAGCAGCAGTGGCTG
GGGCCCGACTTCCACCTGCCCGGCATGGCCGGCAACGCCATGGTCAAGACCAACGTGCCCGACCGACGCGAGCACTTCCG
CTACAGCACCCTGATGGAGGAGTGGGAGATGTGAGTCGAGCGCTGTGGTGACAATGCTTAGTCATTGCTGACATAATCAG
GATCAAAAAGTACACCAGCACCGGCTCGACCGTGGCAGCCAGCGCTCCGGGCACGGCGGCACCCCGGTCGCCGGTTGCGC
CCTCGCCGCTGCCAAAGAGAAGCACCTCTGTAACCGGAAGCAGCCCGGTGGCCAGACACCGGACGACGAGCTTTGCGGCT
CTGCCAGCAGCCGGCCAGCTGCAGAGCCCCTATCTGGGCCCGACGTTGACGCCGGGGTCTGCCTCGGCTGCTGCGCTCGG
CATCTCCGGGAACATGACACCCTCGTCGCTGCTGGCGGCGACATCCTCAGCCACGTCGTTGCTGCCACCGCTGCCACCAC
CCACACTCTCCGGCAGCGAGCCGCGGTACTTTCCGGGCGTGGTGACACGCAGCCAACGGCGCAACAGCATCAGCAACGGC
ATCAGTGGCAGCAGCTTGAAGACGACAGCAGCAGCAACGGTGCGGCTGCCAGACGACAAGGTGGCAGAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62