GenePrediction:GLEAN_4360 Details

Name: GLEAN_4360
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:416598..415488 (- strand)
Length: 1111
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:416598..416229 (- strand)
Length: 370
Type: CDS
Source: GLEAN
Position: GCSC_179:416128..415488 (- strand)
Length: 641
>GLEAN_4360 class=GenePrediction position=GCSC_179:416598..415488 (- strand)
ATGAACGAAGCTTCAGACAAGCCTCCCAGCAGTGAGGTCCAGCTCGCCACAGCCGCCCACGTCAAATATATCCAGGGCCT
CAACTCTCACCAGGATGCCTATGAGTTTTGGCTGACTGAGCACTTGCGCCTCAACGGCCTCTACTGGGGTCTGGCCGCGC
TGCATTTTTTGGGCCGTCCAGAGGCTCTTCCCCGCGATGAGACTATTGATTTTGTGCTCTCATGCCAGCACGACAATGGT
GGCTTCGGCGCTGCTCCGGGTCACGACGCTCACATGCTGTACACCGTCAGCGCCATACAGATCCTCGCCATGGTTGACGG
CCTGGACGCTCTCGATTCGCGGGGAAAGGGCAAGGCTACGGTTGGAAAGTGTATGTGCTTCACTCTGGATGGCACAGGCT
AGGCAACCGCTCTCATACACACACACACCCACTCACACACTCGCTATCGCTCATGCTTACACTCCTCCAGTCATTTCCGG
CCTGCAAAACCGCTCAACCGGCACCTTTTCCGGCGATGAGTGGGGCGAGGAAGACACTCGCTTCCTGTATGGCGCGCTGA
ACGCCCTGTCCTTGCTCGGTATGCTCTCTCTTGTCGACGTTGGCAAGGCCGTCGAGTACGTCGCCTCATGTGCCAACTTT
GACGGCGGCTACGGTTCTCGTCCTGGTGCCGAGTCCCATGCGGGTCAGATCTTCACCTGTCTGGCCGCCTTGTCCATCGC
CGGCCGCCTCGACTTGGCTGATGCCGACAAGCTTGGCCGCTGGTTAAGCGAGCGCCAGATCGTGGGTGGCGGGCTTAACG
GCCGCCCGGAGAAGAAGGAAGACGTCTGCTACAGCTGGTGGGTGCTCAGCAGCCTGACACTCATCAACCGTCTCCATTGG
GTCGACCGCGACCAGCTGGTGGCCTTTATTCTTCGGTGCCAAGACCCAGAGGACGGTGGCTTTGCTGACCGGCCCGGCAA
CATGGTCGACGTATGGCACACCGTGTACTCTGTGGCTGGCCTAAGCCTGCTCGACTATCCCGGGCTGGTGCCCGTGAATG
CTGCATATTGCATGCCCAAATTGACAATTGCCCGTGTTGTTGGGCCACGGGGAGACGCTGAGTCTGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62