GenePrediction:GLEAN_4361 Details

Name: GLEAN_4361
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:413539..411632 (- strand)
Length: 1908
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:413539..413228 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_179:413163..412278 (- strand)
Length: 886
Type: CDS
Source: GLEAN
Position: GCSC_179:412068..411632 (- strand)
Length: 437
>GLEAN_4361 class=GenePrediction position=GCSC_179:413539..411632 (- strand)
ATGGCTGCTGTCGCCCCGATGGAGGTTTGTAAGGGAGAGGATATTCGGCCCATTCCGCTGGAGTGTGTCCTTTGTCCAAA
AAGACCATCCTTTTCAGACGTGTCGCACCTCTTGACCCATGTCTCGTCAAAATCACATCTGCATCAGAAGTTCAACATGG
AATTCAAGGCGAAGACTGAAATCGGAGCCAGGGAGCGCCTCCGGCGCTATGAAGAATGGTATTCCATAAACGGGATCGAG
ACGCTACTGTCAGACCGGCTTGCAGCCAAGAATCACAAGACAGCTCGCCGTGGCCGTTCTTCAACATCATCAGTAAGTTC
ACGTGGCTTATTTCGCTGGCATCGAGAAAATGCACTAAATAAATAACAATACATAGGCAAAGTCACGTCAGTCAACAAGC
ACTGTCGATTCTATAAAGATGGATTTCGATGCAGCATCGGGATTTCACACGCCCGACCATTTTCCTGCGACCGGCCATTG
GAACGCCACTCCGCTTTTTTTCAATGATACCCCGAATACTTCATACATGGACGAATCGGCTTACCATACGCCAGCTTCGA
ATGGACAACAGCCTAGCTATTTCTTTCAAGAAAATGCCGCTGTTACCAACTCTGATATGAGACACCAAAGCCTCATGTCT
GATATAGATTCAATCTCTCATACGGTCGCATCTGATTTGGACAGAGCTCTTAGCATTGACCTACTGGACGATGACGGGCA
GGAAAACAGACTCAAAGGTGTTGTCTGGCCAGGAATGGCCTTGTTCGACTCTGCGACAGCGGATCAGAAGCGGAAAAGGA
ACCAGCGCAAAGATGGGGGCGTGATTGAACAGATGAAGCTGACTTCTGAAGCTGTGATGGCCACCGAGACGGTCTGGGGT
TTGAATGGAGACATTTATAAAGTGCGGGACATTTACGCCAGTCCGTCTATCGACGGAAGCCCTCCAAACAGCCCTGTCCG
CAAGAGAAAGTACCGGCCACGAAACACTCCGACGATAACTGGTACTTTGGAATCGTTGGGGGTGGGAGATGGGATTGACG
GCCGTCCGAAAAGGAAACGTGCTGGCAGAACAACGGCGGGCGAGGCGACAAACAGCCTTCAGACGAGGGGTGTCGGCAAG
ACTGGTGAGAAGGGAGGCAAAAAGAAGAAGGCCGAAGGACTGGATACGATCTGCGGAGCAGAAGTTCATGGCTTGCCCAT
GGTCGATGCCACGGACAGGGCTACCTTCAACGTGTTTTACGAGGGGTCGGGGAACAACCAAGGTAACATTCCGATATTGC
TTGTCTCTGCAGTGACTTTGTGATCTATGCCGAGTGGAGAAACGAAGCTAAATCGATTGGTACAGACATGGACGCCACAG
AGAGCCATCTGGACGATGTTCTACATGGCAACGGGTTGAGTTCTAGCCAGACACCACCCAATAGCGATGATGAGTGTCTG
ACAATGTGACTACAACATAGATTTGATCCAGGTCAGCACAATCGACCAGCTCTGCAGCAACTGGACCCAAATATGAGCCT
AGCCGAATCGGGCTCGTTATTCAAAAATGCACAGTCGAGTCGTTTCTTTGACAGCGAAGCAGAGTCGGCACAACTGGGGT
TCCGTTCGCAAGCAGCGTCATTTGGCAGCGGACTTCATGGTATGGGAAACAGCCCCATGACGTCACTGAATGCACACAGC
GGAGGGATGTATGCGACATTTGACAGCCAGCTGTTCGCTGGGGGCAACGGGGACGAGGGATCGACAGGGCCGTTTCATGG
GGCTCATGGGCGGCGACTGGGCTTCGCATTCGGGTTGGATGCGAATGCTAACCCGTTTGGATTCGTGGAGCAGCGCGACG
CTTCTCTGCGGGAGCCATCGTTTTCCGAACAGGCCTTCCGCAACTCGGCGGCGCTGTTTGACGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62