GenePrediction:GLEAN_4362 Details

Name: GLEAN_4362
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:396581..395241 (- strand)
Length: 1341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:396581..396562 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_179:396501..395241 (- strand)
Length: 1261
>GLEAN_4362 class=GenePrediction position=GCSC_179:396581..395241 (- strand)
ATGCCTCGACGCAAGTGGATGTAAGCATGCGCTGCCTGGCTGCCTGGCATATTCTTTGCCGTTCTGACTGGTATTGGCAG
TGACAAGAAGTCGGCGTCGCACTTCACGCTCGTGCACCGGCCCCAAAATGATCCGCGCATCCACGATGAGTCGGCACCGG
CCATGGTGCTGAACCCGACAGAGACACCGAATGCGCACAAGTCCAAGAAACTCGACGAGCTGGCCTCGCAGCTGGGCGAG
GAGGCCGAGCAGATCCGGTCCAACGAGGGCGAAGCGGCCAACTATGGCGTCTACTTTGACGACTCGTCATACGACTACAT
GCAGCATCTCCGGGAGATTGGCAGCGGCGGTGGCGAGGCCGTCTTTGTCGAGTCGTCGGCATCGCTGAACAAGGACAAGG
GGAAGCAGAAGCAGCCGCTGGCCGAGGCGCTGAAGCAGATGGACCTGCAGGACCGGTCCGAAGACCTGTTGGACGAGGAC
ATTCTGCCGTCCAAGAACTTGCAGCGGGTGACGTACCAGAACCAGCAGGACGTGCCCGACGTCATTGCCGGCTTCAAGCC
GGACATGGACCCGCGGCTGCGGGAGGTTCTGGAGGCGCTTGAGGACGAGGAGTACGTAGACGACAACGACGATGACCTGT
TCAAGCAGCTGGCCAAGGACGGCGAGGAGCTGGACGTATATGCGTTTGAGGACACGTACTCGGAGCAGGCCTTTGACGAC
GAGGATGACGAGGGCTGGGAGTCGGACGCGACCGAGCGACCAGCCAAGGCCCGCAGCGAGGACGGCGAGGGCGAGGACCA
AGACCGGGTTCCCGACCTGGTCGACACGGCGACAACGGGCAATGGGCCGCGGCCATCGGAGGCGTGGATGGAGGACTTCA
ACCAGTTCAAAAAGGACCAAAAGGACCAGACCAAGACGCGCAAGCCGATCGTGCCGGCCATGTCGGAGATCCAGTCGTCG
ATCTGGACGACGACGACCAATGGTGGCCGCAAGAAGAAGAGAAAGGGGGCGCTGACGCAGCAGTCGGGCTTCTCGATGAC
ATCGTCGTCGCTCGTGCGCACAGAGCAGCTCACGCTGCTGGACGCGCGCTTCGACAAGATCGACGAGCTGTACAACGAGG
ACATGGACGACATGAAGTCGGTGTCGGCCTTCTCGTCCGCCTCCAGCGTGCAGGGGCCGATGCGCGGCGACTTTGACAAC
ATCATGGATGACTTCCTGGGCGGCTACTCGATGCAGGGCAAGCGATCGATCCGCAAAGGCCGGCCCCAGACCGGCATCGA
GCAGCTCGAGGAGATCCGTCAAGGCCTGGGGCCTGCACGGCTGACGACGCGGCGGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62