GenePrediction:GLEAN_4365 Details

Name: GLEAN_4365
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:346071..344741 (- strand)
Length: 1331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:346071..346047 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_179:345965..345878 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_179:345794..345723 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_179:345668..345635 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_179:345557..345344 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_179:345286..345195 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_179:345125..344991 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_179:344917..344891 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_179:344827..344741 (- strand)
Length: 87
>GLEAN_4365 class=GenePrediction position=GCSC_179:346071..344741 (- strand)
ATGCATATTCAGTCCATTCCCATGTGTATGAGAACCTCTTTCACCCCATAAGACGGACATCTGTAGTTTTGCGCCCGGAG
CAATTCTGACTATTTGCCTGTTCTAGGGGTCGGCACGGGCGACAACTATGCCTACCTGCTTATCGATGACAAATCCAAAG
ATGCGGTCATCATCGACCCGGCGAGCCCAGAAGAGTGCGTGATGTTGTCAACTAAATTGGGACGGTTCGGCCGTCTGTCG
AGCAGAGCCTCCGTGCTGATTCTGACACAAAGCACAGGGTTGTGCCGGTGCTCAAGGAAGCCATCAAGGCTGGCAAGATC
AACCTGACGGCTATTGTCAACACGCACCAGTAAGTCGGGAGCAACATGTCCGAGACCACGCCCCAGCAGCTGACAGCAGC
AAGCCACCGGGACCATTCTGGAGGAAATGTCAGCGTGGTAAGTCCCGGACATGAACGTCCTTTGTCTGCCCTTTGCTGTG
TTGCCGGCACCATCTGACTCTGGCTTGGCCTCAGCGCAACCAACTCGGCCTCTCCGACCTGCCCATCATCGGCGGTAGGG
ACTGCGCGGCCGTGAGCCGCATCCCGCCGGATGGTGAAGTGTTTCAGCTCGGCAGCATCGCTATCAAGAGCATCTATACG
CCGTGCCACACCCAGGACAGCATCTGCTGGTTCGTACAGGACGGCGACGACAAGGTCGTCTTCACGGGCGACACGCTATT
CCACGGAGGTGAGAGAATGAAGAGGATTCCACCGGATGCGTGCCAAAGCTTACCCACCCTCTCAGGCTGCGGCCGCTTCT
TCGAGGGCACCGGCCCGGAGATGCAAAAGGCTTTGAACGTGACGCTGGCTGCGCTGCCGGATGACACGCGCGTCTTTGTA
TGTCCTCTGCCTTTCTTCCTTTTTCTACCTTTTTCTCCTTACGACAGCACATTCTCACACTGCAAGCCCGGTCACGAATA
CACAAAGGCAAACGCACAGTTCGGCTTGTCCGTCCTTCCCAGCCCGGCCGTCAAGAAGCTGCTGGATTTTTCTATTGCCA
ACACCGAGACCCAAGGCCACTTCACCATTGCTGACGAGAAGGTATGATAACGTGGTTTGACTCCGATCAGGTTGGCCTGT
TGCTTTGTCGTGCTGCAGCTAACATGCTCGCCAGGCTCACAACGTCTTTATGCGTGTTGATGTAAGACTATTACCTACGG
ACGAAACTCGCTTTACCATGCTCGACAATACTAACAGCATGCAGGACCCCATCATCCAAAAGGCAACCGGCGAGACCGAC
CCCAGTGCTGTCATGACAAAGCTCAGAGAGTTGAAGAACAATTTTCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62