GenePrediction:GLEAN_4367 Details

Name: GLEAN_4367
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:335625..333641 (- strand)
Length: 1985
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:335625..335541 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_179:335405..335169 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_179:335089..334979 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_179:334899..334091 (- strand)
Length: 809
Type: CDS
Source: GLEAN
Position: GCSC_179:334031..333801 (- strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_179:333742..333641 (- strand)
Length: 102
>GLEAN_4367 class=GenePrediction position=GCSC_179:335625..333641 (- strand)
ATGTCTGCAAGACCAACAACGCCATCCTCGCCCAAGACGGTCAAGCTGAAGAGCCCCGTCTCCGGCATGCCCATGTACGG
CTGTGGTGAGTAGAAGCCCTTGGGCACGAATGCAGACATCATACGACTGCTGTCGTGTGGAGAGGGAAGGGGAGAGGCCG
AGAGGGGTGTGCGAGAGAGAGAGAGCCATGAATAACTGCTGACGGCCCCATGTTGTACAGAGCATGTCGAGCTCCTCTTC
AGCCAGGGCCAGGACACCATCAACACCTCCATTTTCCACTACAAGATCATCCTGCGCAAGATATTCGACCAAGCACCGAT
CGTGCCGCAGACATCCAAATCCGCCGATGGCCAGCCCGTCACGACGCTGACGCCCAATTACCTGTGCCTACAATGTCCGA
CCACCCTGACCGAGGAGGACATCTACAGTCACGGGCAGAAAAAGTCGCATCGTTTCTGTACGTCGTTGGCAATGTGGCCG
TGTCCCTTGCCGGGATTGTTTGGGCTGACCGGTGCTGTGTGTTGTGCGGTGTGCAGATGTAGAATCAAGATGCGGCACGT
TGTACTGCCACATGTGCGATGACTTTGTGTACGATCCCACACTGGAGGAGTTGCGGCTGCGCAAGATCGGCACGGGCTCG
TTTTCAAGTAAGGAGCCTCCGGGCAGCGGTCGATGGGGAGGCAGCGGTCGGGCAAGACGCAAAGCTGACAGACTCGGAAA
ACACAGCCAACCGCAAGAGGAAGCACGACGAGCTCTTCTCGGACTCGCTCAAGGATGACCCGCGGTACATTGCATCGAAC
ACGACGCTGGCATCGTGCCGGGCAAGCGGGCTGCGCGGAATCTACAACGCGGGCGCGACCTGCTACCAGAACGTGATCCT
GCAGTGCTTCCTGCACAACCCGCTGCTGCGCAACTTTTACCTGAGCGACGGACACCAGAGCTCGCTGTGCGAGGCACGAC
ACTGTCTCAGCTGTGCCATGGACGACGTGTTCCAAGAGTTCTACGGGCAGGAGAGCACCAACGGCTACACGGCAGCCAAC
ATCCTGTCGAGCTTCTGGATCTCGGAGCGCAAGGCGTTTGCCAACCTGGTGACGACCAAGGAGCAGGACGCCCATGAGTT
CTTCCAGTTCCTGGCCGAAGAGCTGCACGAGCGCAACGGCGACGGCAAGAAGCCCGAGCACGGCAGCGAGCACTCGTGCA
CCTGCATCGTGCACCAGACCTTTTACGGCAAGATGCAGAGCACCACAACCTGCCAGCAGTGCAACGGCATGACCAACCAG
GTCCAGTCCTTTCTCGACCTCAGTCTCGGGCTCGAGAGCCTGGCCCACCGCCAGAGGCGTCTGGCCAAGGGACTGTCGGC
CGCTGCAGCCGCTGCTGGGCCTCCGCATCGTCTGACCCTACAGCAGTGTCTGGACGAGGAGTACATCAAGTCGGACAAGT
GCGAGTACCGCTGCCACAGCTGCAACTCCACGCGGCTGGCCCGACGGCACACATCCATCAAGGCGCTGCCGAATGTGCTA
TCCATTCAGCTAAAGGTGCGTGTGCAGGCTTCTACAGCTTCTGGTTGACTTGCCTTCACAGCTAACCCCTACAGCGCTTC
GAATACAAACAGGGCCGCCATGACAAGGCCGCAAAGGTCGATACGCCCGTCGAGTTCCCCCTACAGCTTAACATGCTGCC
ATACACAAATCGCAGCCGCGGCCAGGACGTGCGCGAGAGCTACGAGCTCAACCGGTCGTGCATGTACGACCTACTCAGCG
TCGTCGTGCATGTAGGCGAGATTGACACGGGTCACTATCTGTCATACTGCCGCGTCGGTGATCAGGTAAGTCGTCTCTCT
CTCTCTCTGCCGTCTCTTCTTCGATGGCTGACCCCTTCTCCAGTGGTTCGCCTTCAACGATCATCGCGTGCAGCTGGCGT
CCAACTCGGAGGTCCTCGGGGCCAACGCCTACCTGCTCTTCTACATTATTCGATCGTTGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62