GenePrediction:GLEAN_4369 Details

Name: GLEAN_4369
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:319822..319367 (- strand)
Length: 456
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:319822..319773 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_179:319700..319367 (- strand)
Length: 334
>GLEAN_4369 class=GenePrediction position=GCSC_179:319822..319367 (- strand)
ATGGGTGTCGTTAACAAGCGCACGCTGACCAAGACTCGGCGCAAGACTCGGTAAGATGGCTTTTTATACTGCAGATACTT
CCGTATGGCATGAAAAGACGGCCCACTAACACCGTATTGCAGGGACGTCGACCAGATCAAGGCCGATCTCGCCTCTCCCG
CCCATCTCGCCCGCCACACATCCTCCAAGGCTGCCGAGGATCTGCCCGGTCTCGGTCGCCACTACTGCATCTCCTGTGCG
AAGTGGTATGAGTCGGCTGATGCTCTCGTGTGCCACCGCCGCGGCAAGCCGCACAGGCGCCGGGTCAAGCAGCTGACCGA
GGTGCCGTATACCCAGAAGGAGGCTGAGGCGGCCATTGGCCTGCGGACGGACAACGGCGAGTCCACGGTCGACGCAGCTG
CAAGCCGGCAATTAATTGGCCAGGCATCTCAGACCGGTGACATTGCCATGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62