GenePrediction:GLEAN_4370 Details

Name: GLEAN_4370
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:315559..311871 (- strand)
Length: 3689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:315559..315377 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_179:315245..315026 (- strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_179:314946..314771 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_179:314710..314279 (- strand)
Length: 432
Type: CDS
Source: GLEAN
Position: GCSC_179:314217..312146 (- strand)
Length: 2072
Type: CDS
Source: GLEAN
Position: GCSC_179:312078..311871 (- strand)
Length: 208
>GLEAN_4370 class=GenePrediction position=GCSC_179:315559..311871 (- strand)
ATGTCGATGCTACCGCAAGAAGTGACTGCTGAGCTGTCCCAGCTTCTGCAGGCACTGCAATCTTCCGAAAACAGTATCCG
GTCTCAGGCCGAAGAACACCTCCATAGTAACTGGACCACTCGCCAACCCGAGGTGCTTCTAATGGGCCTCGCTGAGCAGA
TTGGCAGCCACGCAACAACAACTGTGTGTATTTGCCTGATATCCTGTGTCCTTGGTCTCCTGTGTTGTCTGTGGGCCGTT
ACTGGATCTCCACCGAGGGAGCCAGGCTCCTTGTTTCGTGTTTTCCTCGGGCTGGTTCTGACTGCCTCTTGCAGGTTCGC
TCATTTGCAGCCGTCATTTTCCGAAGAATTGCTTCCAAAACACGCAAAAATGAACAGGGCGACCTTGTCGAGATCTTCAT
CTCGCTGCCTGCAGAACAAGCCCAGGCCATTCGCCAGAAGCTTCTGGAGGTTTTGACTGTCGAGGAAGATCGCGGTGTTA
GGAACAAGATCAGCGATGCCATTGCCGAGATCGCCAGACAGTACACTGATAACGGTTCGTCGAGCTCGATCCTTTCTTCC
CGATTGTGCGCGCGTCCCATCCCATGCTGACCCATTGGCATGACGCTGTACAGACCAATCCTGGACCGAACTGCTGCAGG
TGCTCTTCCAGCTGAGCATGGCCCCCGATGCCGGGAAGCGAGAGATTGCCTTCCGCGTCTTCACGACCACCCCTGGCATT
ATCGAGAAGACTCACGAGGATGCGGTGGCCCAGGCCTTTTCCCGTGGCTTCAAGGATGACTCTGTCACTGTACGCGGTTA
CACATCCAACACCCTGTCCCTATGAATACGTGTCTGACGCCCCGAGCAGGTTCGCATCGCCGCCATGGAAGCGTTTGCTG
CCTTTTTTCGTGGACTGAAGAAGAAGAGCCAGCCGAAATTCTTCGGCCTCCTACCGGAGGTTCTTAATATCCTGCCACCA
ATTAGAGAGTCGCACGACTCAGACGATCTCAGCAATGCTCTGGTTGCGTTGATCGATCTTGCCGGAACATCACCAAAGAT
GTTTCGTCCAGTGTTCAATGTGCTTGTTAAATTCAGCATCTCCGTCATCCAAGACAAGGAGCTGACCGACTTGTGCCGTC
AAAATGCCCTCGAGCTGATGGCTACGTTTGCCGACTACGCTCCATCCATGTGCAAGAAGGACGAGCTGTACACGAACGAG
ATGATCACACAGTGCCTAAGCCTCATGACGGACATTGGCGAAGACGACGACGACGCATCCGAGTGGCTTTCCGCCGACGA
CGTAAGACTTCCATTGTTGCTCTATAATCTGTGCTCATGTCAATGCTGACCTGTTTGTGCAGCTCGAACAAGAAGAGAGC
GATCTGAACCACGTGGCTGGCGAGCAGTGCATGGATCGGCTGGCCAATAAACTTGGCGGTGCTGTCATTCTCGCCCCCAC
ATTCAGCTGGCTTCCGCGTATGATCAGCTCTTCTGCCTGGAGAGACCGCCACGCTGCCCTCATGGCCATTTCTGCCATCT
CCGAAGGTTGTCGTGACCTGATGCTGGGCGAGCTGCAGCAGGTGCTCAACCTGGTGGTGCCGGCCTTGAAGGATTCGCAC
CCACGTGTCCGCTGGGCTGGCTGCAACGCCCTCGGCCAGATGAGCACCGATTTTGCACCGACGATGCAGCGCGAGTACTA
CGACATTATTCTCAAAGCTATCATCCCTGCACTGGACTCGCCAGAAGCCCGCGTGAAATCACACGCTGCAGCTGCCCTGG
TCAACTTCTGCGAGGAGGCTGAAAAGAGCGTACTGGAGCCGTATCTCGATGATCTGTTGAGCCACCTCTTCAATCTGCTG
CAGAATGAGAAGCGTTATGTTCAGGAGCAGGCCCTCTCGACCATTGCCACTATTGCCGATGCTGCAGAGCAGGCGTTTAG
CAAGTACTACGACACACTGATGCCGCTCCTGGTCGGCGTTCTCCGGCGGGAAACGGAGAAGGACTACCGCCTGCTTCGTG
CCAAGGCCATGGAGTGCGCAACGCTGATTGCCCTTGCCGTGGGCAAGGAGCGGCTCGGCAACGACGCGATGGAGCTGGTT
CAACTCCTGGCCAACATCCAGAACAGCATCACGGACGCAGACGACCCACAGGCGCAGTACCTCATGCACTCTTGGGGTCG
CATGTCACGGGTTCTGGGCACGCAATTCATGCCCTTCCTCCCCACCGTCATGCCGCCACTGCTGCAGCTGGCGGGAGCTA
AGGCCGACATCCAGCTGCTGGACGACGAGGAGCAGGCCGATCGTCTTCAGCAGGAAGACGGCTGGGAGCTGTTGCCGCTC
AAGGGCAAGATGATCGGCATCAAGACTAGCAGCATGGACGACAAGCACATGGCCATTGAGCTGCTCGTTGTGTATGCGCA
GGTACTCGAGGGCTCGTTTGCGCCATATGTGGGACAGATCATGAAGGACATCGCCCTGCCAGGTCTGGCGTTCTTTTTTC
ACGACCCCGTGCGCTTCATATCGGCGCGGCTGGTGCCCCAGCTGCTCAACTCATACAAGCAGGCATACGGCTCGGAGTCG
AACGAGATGACGGCTCTGTGGGGAATCACAGTGGAGAAACTCCTGGAGGTGCTCACAGCAGAGCCGGCCATCGACACACT
ATCGGAGATGTACCAGTGCTTCTACGAGTCGGTCGAGGTGCTTGGGCGACCCTGCTTAACACCAGTACACATGAACAAGT
TCATCGAGGCGGTCGAGTCGACGCTGGAGGACTACCGGGAGCGCGTGACCCAGCGCGAGGAAGAGAAGCGGAACACGACG
ACAGAGGATGCCGAGGACGAGGACGAGGATCTGCTGATTGCGTTGGAGGACGACCAGACGCTGCTGTCGGATATGAGCAA
GGCCTTCCACGTGGTGTTTAAGTTTCACGGGTCAGACTTCCTGCCGGCGTGGGAGCGCCTGATGTCGGCATACGAGAGCT
TCCTCAAGGCGGAAGACCCGAGCCAGCGGCAATGGGGCCTGTGTATTATGGACGACGTGCTTGAGTACTGCGGCGCGAAC
AGCATTCACTACGCCAATTACATCACGCAGCCGCTGCTCGACGGCTGCAAGGACCCAGCACCTGCGATACGGCAAGCGGC
CGCATATGGCATCGGCATGGTGGCACGCCAGGGCGGACAGGCATGGTCGCAGTTTCTCGGCGGTTGTGTGCCACTGCTCT
TCCAGGCGACCCTGATCCCAGATGCACGGAACGAAGACAACGTATACGCGACGGAGAATGCGTGCGCAGCCATTGCGAAG
ATTCTGCACTTTAACGTTGGCAGCGTGCAGAACGTCGACGCCGTGATCACGGAGTGGGTGGGCACGCTGCCCGTGGTCAA
CGACGAGGAGGCGGCACCGTACGCCTACGCCTACCTGGCCGAGCTGATCAGCAAGTACGTATAGCCGGCAGACGTGGAGT
TTTGTGAGCAGTCAGAGCAGAGACTAATGTGCTTTGAGCAGGCGTCATCCGGCAGTCATGTCGCAAGCAGACAAGGTGTT
TACGTTTATCGCACAGGGCCTGGGTGCAGATGTGCTGCGCGGGCAGACCGCGTCGAACGTGGTGACGGCAACGAAGGTGA
TGTTGCAGGAGTCTGGGTTGAACGCAACGCCGCTGCTGCAGCAGTTCCCGCAGGAGTTGCAACAGACGATTAGCGCTTAC
TTCGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62