GenePrediction:GLEAN_4372 Details

Name: GLEAN_4372
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:298384..295657 (- strand)
Length: 2728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:298384..298160 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_179:298083..297943 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_179:297882..296971 (- strand)
Length: 912
Type: CDS
Source: GLEAN
Position: GCSC_179:296906..296711 (- strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_179:296646..296124 (- strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_179:295747..295657 (- strand)
Length: 91
>GLEAN_4372 class=GenePrediction position=GCSC_179:298384..295657 (- strand)
ATGCAACCGCTCCTGTCCCCCCACCTTGCAACCCTGAACAATGGCTTCGCCGATGCTTCGGCCCATGGCGCTGGCTCCTG
CACCTGTGCCGTGCTGCCATTTCCATTGGTCAACCCTGCTGACTGCTTTTCGCTCTCCCTCCCGCCATTTAGGATGCTGG
AAGATCCCACATACAACTCGGTCGTCAGATGGGGCAACGATGGGGCCAGCTTTGTCGTCTTGGAGGTACGTGCTGGCCAT
GCAACTCTGCTTCTTACAGACCATGTCGCCATCCTAACTCGCCGGGCTTCCTGCCTGCTAGAACGAGAAATTTACAAAGA
CCATATTACCAAAACACTTCAAGCACAGCAATTTTGCCAGCTTTGTCCGGCAGCTGAACAAGTACGACTTCCACAAAGTC
AGACACAACGACGAAGGCGGCCAGGCCACGTATGGCCATGGAGTGCGTTCCCTTGCTGCGATGTCTCTGGCCTCTGCCCC
GTGCTAACAGCCCCTCGAACAGGCCTGGGAGTTCAAGCACCCCGAGTTTCGCCAGCACAAAAAGGACAACCTGGACAACA
TCCGGCGCAAAGCCCCAGCTGCGCGGAAAGTCACCGTAGCCGAAGAGCCGTTTCCGGCCACACAGCAGATCGTCCTGCTT
AATGACAGCCTCACAGCCACGCAGCACCAGGTCCAGGCCCTACAGGAGAGATACACACAGATGGCCCAGACGAACAAGGT
ACTTGTCGACGAGCTGTTCAGCATCAAGAAGCTGGTCAGGGCACAGCACCAGGTCCACATGGAGCTGATCACCCACCTCA
ACAACATCGACGAGCAGCGGCGCCGCACCATACGGCAACCGGGCCATCCGAACCACCCAGGACACAATGCCTCCGGCCAG
TACCATCATCCTACGGGTGCCGGTCTCGGCATGCTTCCTGACGGCGCCGACGAGCCTGCGATTGAACTGCGTCGGGCGCG
CGAGATCCTCAACAACGTGTCGACGGAGTCCGTGGCCGACCGCGAGCTCGAGCGGCTCACCACCATGTTCCAGGCCAATG
CCGGCAACTCACCACCCGAGTCGGCAGGCTCGTCGTCTGTCATCTTCAGCGCTCCGGGCACTGGTGCTGGCAGCGTGTCT
ATCGGCATGAATGACATCAACGACATGCGCCATCTGGTGTACCCGGCCGGTCAGAATGCTGGCATTGATCCGTTCCACGC
TGACCACATCAACAATATTCCGTACACGCGGCCGCTCAGCAATCCCAACGCAGGGCCGGAGATGGTCATTTCGCCGTCGC
TGCCATCAAAAGAAACAATCGGGTCGCTGTGGGGCAGCCAGAAGCCCAAGATCCTCCTGGTCGAAGACGACAAGGTGTGC
GCACGAATTGGCGCCAAGTTCCTATCGCAGGTGGACTGCACCGTCGAGATTGCCGTACGTCTGGTCCTACTATTCCTTTG
AGACGCCGGGTGGATGACTGACGTGAGCGACGCAACAGAGAGACGGATCCGAGGCAGTGGCCAAGGTCAACCAAGAGCCG
GAGCGGTTCGATCTTATCTTCATGGACATTATCATGCCCGTGTTCGACGGCGTGTCGGCCACAGCTTGCATCCGCATAGC
TGCGCCGCGCATCCCCATCGTGGCCATGACGTCCAACATTCGTAGTGAAGATGTTGCCACCTATTTCCACTGGGGTGAGT
TCGCTTGCGCTATGTTGATCCTGTCCGGGTATAATGCTGACGTGTGCGTGACGTGCAGGCATGAACGACGTGCTGGCGAA
GCCGTTCACCAAGGAGGGCATGGTGCGGATTTTGAAGAAACACCTGCCCTATCTGCTGAAAATTCCGCCGCAGCCTAGCT
CGGGCGAGGACATGGCTCAGCTGAGCAGCAGCGGGCCACCACCGGGATATATCAACCCCGGCAACATGGGGCCGATGAAC
GCGATGCAGGCACAGCAGAGCCTGAGCGCAATAAGCGCGAGCGGAGGTGTCAAATTCGAGACCACACCGATCCAGTCGCC
GGCCACGTCGGCCTCGTGGCATTCTCCCAGCACTGCGCAGATCCAGCACACGTCTCCGAATATGGATGCCAGCGCCGGGT
ACATGCCGACGTCGGTGAATGGCGGAGGCAGCGGTGGTCCCAGCACCGGTGGTCCCGTCCCCAACATCGGTCCACGGCAG
CCGTATCCAGGAGGGCCGTCGCCCGCAATCGGCAGCACAGGACTCCGCGGACTGGCAGACCCGATGACCCACGACGAGCG
GCCAGAGAAGCGGCAGCGGTTGTATGCGCACGGACAATACACATGAGGCGTTGGAGTCCCGTCGACGCGACCGTGTTGGA
GCGTTTTCGCTTCTGCTTCTCCTTGTTTCTGTTGTAATACCTTTTCGTGTTTCCCTCTTCTGGCTTCATATTTTCTCCTT
CTCGTTTCGACCAGTTTGAAAGGCTCAGCCTGCACTTACCGAATGATACCTATGGGACTGGAACTCGGGGCTATTAGGGG
CGGCCAGGGTTGGCCAAAGGCGGCCATGGGTGGCCACGAGATGTCAGGGGAGGTCAGGGGCTGCTTGCGGGGAGCACGAC
TCTCTTTGGCTAGCAGACGGGAGACTGGATATGTACCAATTGGCGTTTCAGGATTGCATTTTCGCCCACAAGTATAGGGC
TTCGTTGGCAGAGCGAGGCATTGCATTGGCCATTATAATGAACGGCATCGTCTGGGATGATTTTGTGCAGTTCCAGGAGC
TACTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62