GenePrediction:GLEAN_4373 Details

Name: GLEAN_4373
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:294448..291069 (- strand)
Length: 3380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:294448..294353 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_179:294290..294234 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_179:294173..292006 (- strand)
Length: 2168
Type: CDS
Source: GLEAN
Position: GCSC_179:291414..291069 (- strand)
Length: 346
>GLEAN_4373 class=GenePrediction position=GCSC_179:294448..291069 (- strand)
ATGGTGCAGTCCAACAAAAAGGCCGCTGCCGGCCGTGGCAAGAAGGCCGGCAAGGGCCAGGTCGACGAGAAGGGCGAGGA
CGTGCTGCAGGCAGTCGTATGTTGGAATCCAGGCCGGACTCTTTGGCACAGGCAGGCACTGACATTCGACGGCCGCAGAT
CCTTGCAGACTCGTTCCAGGACCGGTTTAAGCCGCTGACCATCGATACGCCCAGAGTGAGAGCTGCTGCCCCTCGTTTTG
CCTGACTTGTGTCAGCTGACCCGGTCTTCCTCCAGTGTCTTCTCCCGCTCGCCAACACGCCGCTGATCGAATACACGCTC
GAGTATCTGGCGATGAACGGGGTGCAGGAGGTGTATGTGTACGTGGGCGCACACGGCGACCAGGTGGAGGGCTATCTGGC
GGCATCGCCGCGCTGGGCGGCCGGCAGCAAGATTAACCCGTTCCAGTCGCTGGACACGATCCGTGTGGCGCAAGCCACCT
CGCTGGGCGACTTTCTGCGGGACCTGGACAAGCGCGGCATCATCGAGGGCGACTTTGTGCTGGTGCACGGCGACCTGGTG
GCCAACGTGCCGCTGGACCCGATCCTGGAGCGCCACCGGGCGCGGCGGCTGGCCAACCGCGATGCCATCATGACCATGGT
GCTGCGGGAAGCCGAGGACGACCACCGGTCGCGAGCGCACGGCATCGAGCCGCTGTTTGTGCTGGAGGCCGAGTCGGGCC
GCTGTCTCGAGTACGACGAGATGACGCCGCTGGACAGCCGGGCGGATCGGCGGCTGATGGTTGACCCGGCCTTTTTCGAG
CGACCGGCCGACATCGAGGTGCGTGCCGACCTGATCGACACCGGAATCGACATCTGTACGCCCGACGTGCTGGCGCTCTG
GACGGAGAGCTTTGACTGTGACCTGCCGCGCAAGAACTTTCTGCACAACGTGCTCAAGGACTGGGAGCTCAACGGCAAGC
TGATCTTTACCGACATCGTGACCGACGGCTATGCTGCCCGTGCCAGCAGCCTGCAGATGTACGACGGCGTGTGCCGCGAC
GTTCTCGGCCGGTGGACGTACCCGCTGGTGCCCGAGACGAACCTGGTCAGCGGCCACTCATACCGCAGCCTGCGGCGGTG
TCTCGGGGGCAACGTGGCGGCCGAGCGCGGCGTGCAGATCAGCCCGTCAGCCACGGTGGCGTCGGCCGTGCTGGGCCTGC
ACACGTCTGTGGGTACGGGCAGCGTCGTGAGCGGCAGCACGCTAGGCCGGCGCTGTCGTATCGGGCGGAACGTGCAGATC
CACGACTGCTACCTGTGGGACGACGTGGTGGTGGGCGACAATGTGGTGTTGACACGGTCTGTCCTGGCGTCGGGCGTTTC
TGTCGGCCGTGGCTGCGTTCTGCCGGCGGGATCGGTGCTGGGTTCAGGCGTCGTTGTGGCGGATGGGTTCACATCGGCCC
GAAGCAGCGGCGACGTCAAGCTCTCGATTGTCGGGCGGGACGGTCGTCGTGTGGCGGACGATGCGGCCGTTGTCGGTGCT
GGCGGCAAGGGAGCGGCATTCCGGTACGAGAGCGATGACTCGGACGACGACAGGGACAGCGAGGGTGAAGAAGACGACGA
CAGCAGCGACCCGTCGACGACGGCGGAGCATCTGCAGCGGTCGCTGATTTTCTCGACGGCCCACCTCAATCTGTCGATGT
CGTCGATCTCGAGCTTTGGCTCGGATGAGGACGGCGAGCACGGGGTGTTTGGCGGCGACGACGGCGTGTCCGCCCACGGC
CACAGCCACGGCGACGAGGGTGGTGATGGCGATGGTGAAGGGTATCTGGGGGTGGACGGCAGCCGGAACGGGTCTCGCTC
GCGGTTCTCGTCCTTTGCGTCGGCCGTGGCCGGCGGCAGTGGAGGTGGTCATGGTGAAGGTGGTGGTGGCCGTGGTGATG
GCAGTGGTCGTGGAGATGGCAAGACAGCAGGGGAAGGCGGCGGCAGCACGTTCCACGCAGACGCCGTGCACGGGCTGCTG
GACGCGTTGCGGGACGAGTCGAGCAGCGACTTTGAGTCGGCGCGGCTGGAGTTTATGAGTCTTCGTCTGGCGATGGATGC
GTCGGACGGTGCGTTGCGGCGGGCGGTGGCGGCCGCATTTGCGCGACGGACGGCCGAGCTGGCGATGGGCGACGATGCAG
CTGCTCCCCCGAAGCTGGATCCGGCCAAGGCGGCCGAGCGAGCTGTCAAGGGCCAGCGTGGTGCAGCGCGGTTTGTGCGG
GATGTCGGCATCGGCGGCGGCTCGGCGGCCGAGCAGGTCGAGTTCGTGCTGGCGCTGCAGCGCACGCTCGTCGGGCTGCG
GATCCGGCTGGGCGAGGAGGTTGCCGCAGCCAGCGGCAGCCCTGCACCCGGCACGCTGCTGGCGGCCCTGCTGCAGCAGC
TCTATGGCAATGACGTGCTCGAAGAAGAGGGCATCCTGGCCTGGTGGGCTGACCAGCGGGCGACGGCCGGCGGCGGCAGC
AGCGGCGGCGAGACCAGCATGGCGGCGGCCCGGGATCGGTGCAAGGTGCTGGTCGACTGGCTCGAGACGGCCGAGGAGGA
TGACAGCGGGAGCGAGGATGATGAGGATGACGATGAAGATGAAGATGAGGAGGAAGAGGAAGATGAAGAGGACGAGTAGG
ATGGCGAATCGGGTGATTGCCAAGCTCGCGCGTTCGTTCCTTCCTCTTCGTTTAGGCAACAAGCTGTCATCACAGGAACG
GGAAGGCGCCAACGTAGGGAGGCAACATCCCTCGAAGCTTGACAAGAGTGTAGTGTCGCCTACACTTGCACACCATTCCA
TTACTTAACTACACGTGACCAACGCCTGTTTATGCATCCGCGACATGTGTCGACATCCGTCAATGTACATCGCGACAATC
TCTCCTTGACGCCCTACCCCCTCACGACCTCCTCCTGCCGCTGCGTCGAAAAGGCACAGAACTTGTCCTTGACTGCCACC
ACCTCGTACGTGCCCTCCTGGCTGGCCCGCACCACCTTGCGATGCTCGTACGAGACGTCGTGTCGGGTCTCCAGCACCTG
GCTGCGCTGGCCCTTGCGTGCGTTCGTGCTGCGCGTGTACGAGAACTCAAAGGGCGGCGTGCCACCAAAGTCAAAGACCA
TCTCGACCGCGCCGCCTTCGTGGATGTCCGACCGTGCCGTCCGGCCCTGCGACACGCGCACCCACGGCAGTGGATGGATC
GTGCGCGTCAGATTGACAGATGCCCGACAGGTCGACGCCCCGTCGCCCACGGCCGTGATGGCAAACTCGCCCGGCGCTTC
GGCTACCCGCCGGAACGTTGTCGACGCCGAGCTGCCCCGCCGCGCCGTCCCGTCAAACGTGTACCACACGTCAAATGGCG
CCGTGCCCGAGAGCGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62