GenePrediction:GLEAN_4374 Details

Name: GLEAN_4374
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:286594..284990 (- strand)
Length: 1605
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:286594..286220 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_179:286152..286058 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_179:285992..285896 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_179:285826..285645 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_179:285588..285341 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_179:285276..284990 (- strand)
Length: 287
>GLEAN_4374 class=GenePrediction position=GCSC_179:286594..284990 (- strand)
ATGGCCCGTCGCAAGGCGTCTGGCGGCAGCTCGGCCCAATCGGCCAAGAGGCCAAGGGTATCAGGAGCAGCGGGAGACGA
GGAGAAGGAGGTGGTGATGGTGGAGCGAAGAACGCAGCCAGAGGGAGAAGAAGCGGAAGAAGAAGCGGAAGCAGAAGCGG
AAGCGGCAGCAGATGCTGACCCTCCACGACGACGCAGCAACCCGCGGCGAACGGCGGCGATAGCGGCAGCAGCCGCCACA
GCAGAAGCAGCAGCAGCAGAGGCGGCGACAGCAGCAGTGCCGTCGGCCGACGAGATCCACGAGCGGGCGTTTGCGCGCAT
CACGACGGCCGAGCGTGACGCCTGGCAGGGCTGGACGGACATTGAGTCAGAGCCGGTGGGTGTCCTCTTGCGCGTCTCGT
CGTCGTCGTTTCCGTCCAAGCTCATCCTCTCACGCGCGCCAGGCTTTTTTCAACTTTATCCTGGGCGAGCTCGGCATCCA
GGGCGCCACCATCCAGGAGGTGTTTTCGGTGGACGAGGCCTCGGCCGACTATCTTCCGTAGGTGTTGGATCGTGTGCAGA
GACGCGGAATGCCGGAAGGACTGCTGACGGATGGCCGCACAGGAACCCCGGCGGGCTCATCTTTCTGTACCGGTTTGTCG
AAGAGGCCGAGGAGGACGTGCGGGAAGACTGTCCGGACGAGCTCTGGTTTGCCAACCAGGTGAGCACGAGTCTACGCCAG
ACGTGCCCAACTGACCTCTGACCTCTGACCACTGACCCCGGACTCCAGACCACGTCCAACGCCTGCGCCACCATCGCCAT
GCTCAACATCGCCATGAATTGCCCCGGTCTCCGGCTGGGCGACGTCCTGACTCGCTTCAAGGCGGCCACCCAGCACCTAC
ACCCGGCTCTGCGCGGCCACCTGCTGAGCTCCCATGCGCTGATCCGGTCTAAGCACAACTCGTTTGCAAGGTGGGTGTTG
TCCGTGCGGTGTGCGTGCTAGCCGAAGAAGCCGTGCTGACCTGCAGACGTCTGGACATGCTGACGTCCGACATTGCCCTG
AAGCACGAGTGGACCGAGGCGGAGCGGAAGCGGCGGCGAGCCCGGGCCAGGAAGAGCAGCAGCCGAAGCGGCAGCATCGG
GAATGAAAACGGCAACACCAAGAAAAAGATCTCCGCCGACGACGACGAGGCCGCCTTCCACTTCATCGCGTACGTGCCCA
TGGGCCAGGACGTGTGGGAGCTCAACGGGATGCAGAACAAGGGACTGCGGCTCGGTAGGTGCTCTGCCCCCTTCTCCGTT
CTCTCTCGTCCTCCTCCTCTCTGATCTGACCGCGAAAGGCTCCTTCACCCGCGACTGGACCGCCATGGCTCGCGAGCGCA
TCGCCGCCCGCATGCTGGCCTACTCCCAGTACGATGACCGCGCCGTGTTCAGCCTGCTGGCGCTGTGCCAGACCGGCGTC
GGGCCTGACGGCGGACCCGACCGCAGCCTGGACGAGGACGTTGCCCGGGCCGCGGCACGTCGCAGCGACTACACGCCGGC
CGTGCACAGCTGGATCAAGAAGCTGGCCGACAAGGGCGTGCTGCGGCGACTGGCCACGGGCGAGGCCGAGGAGAGGGGGG
AGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62