GenePrediction:GLEAN_4376 Details

Name: GLEAN_4376
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:266025..263704 (- strand)
Length: 2322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:266025..266001 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_179:265616..263704 (- strand)
Length: 1913
>GLEAN_4376 class=GenePrediction position=GCSC_179:266025..263704 (- strand)
ATGTTCGGGTCTCTGACGCATTTCTGTAAGCATGTCTTTGCTGTCTCCCCTCTTCTTACCACCCCTTCGTCCCTCAAATG
TCACCACCCCTCTTCCTTGCCATCTCGGATGCTCACTCCGGCTCCGGCTCTTTCGTCTGGCTGTCAATCTCACTTTCTTC
GGCAATTTCTTTCTCTCTTCCGTTCACCCTCTCTTCCGTTCACCCTCTCTTTACTCCATTCTCCCACCCTTTCTCTCTCT
CTCTCTCTGTCCCTAATCTTGTGCAAGCTGCCCTTTCCTTGGTTAGCAGCTTGACGAATGTTTGTCAGCCTTCTTATCGT
CCTGCCTGTTTCTCCATTCGTCGTCACCTACATATCTGCTATCTATAAACCTCTTTCTGCTTATCTAACCTCTCTTTCTC
CTCGCATAGCTGTTTCCCTGCCTCCCTCAGAGCCACCGAAGAATGTGCCACCACCTACACCCATCCACTTTCCCCGCTGC
CACCCACAGGTGACGGACGACGCCGCATCCGTCTCCACAAGCACAACCACGGGTGAACGCTGCTGTAAACAACCCCTCAC
TCGACTGCTGCAGACTGTCGTCCGCCCCACTGAAGTCACCGCCGAGCATTTCGAGGCCCTTGGTGTGCACGTCCGGCCCG
ATGCCACTCTCGCCGACCTCATCCCGGACCCGAGCGTGATTCCGGACTTTGCCACTTGGGACAAGACCGAATATGAGGCT
GCCCGCAGCCAGAATGACCAGACCCGCCATCCCATCAGCAACGGCAACCGGTCTCCTGGCATCCAGACATACCTCGATCG
CAAGCGCGAGCTGTCCATCGACAACAATGCCGCCTATCGCTCGGTGCGTCGCATACAGCCCCAGCAGGGCCAGCAGCTCG
TGCGTCTGGGCAATGCCTACGAGTTCTTCCGCCAGCTCGAGAGCTTCACGACCTTCTGGGAAGACACCTCCATCACGCCA
CCGCCACCACCAACCCCACGGCGACCAGCGGCCAACACATCTGATCCCTCCGGAGCTCCTTCGTCTCCGTCTAAAGCGGC
CGATACCGCTAGCAGCAAGACGAACGGCGGAGAGGATGGCGATGGCGATGTCGACTCCGTCTCGTCCGCCTCATCAGCAG
CTGTAACTGACTCTGAGGGTAAGGCCCCCGAGAAAGACAGCGGACCGCCCGAGATTCGCTTCTACCGGTCCAGCACAGGC
TCGCAGATGCCACCCGAACTTCGGCTCAATATCCTGTCGGCCTTTCTGAAGCTGATTGCCTATGACTTTGGCTGCAACGT
GTCGCCGCCGCGCATGGAGCCGAGGCTGTATCTCAACGCCGGCAATCTGCCGCTGCCTGAGGAGGGAAAGGAGCCTGTGC
CCCCGTCAAAACGCAAGGGCCTGAGCTCTTACTTTACCTCAGGCTGCATCTTCGTCTTCCGCATGGCCACCACCCGTGAG
GCCGCGCGTGCTGGCATCGTCGAAGGGCCCATGGCAGCCGTCAGTGCGCGGCACTCGACTTCGTTCCCTTCTGACGAGGA
CTTTGTAGATGGAGTGCTCCCCTGGGGCGAGGACAAGGACGGTTGCATTGACCTCGCTCGCGAGCTGGTCGCAGCGCTTC
TGACGGCCCAGCAGCGAGCACGCCATGGCCGGGCAGAGCGACGGCTGGGTGAGGGCGAGTGGTGGGCGACGAAGCGCCGG
TGGGGAGGCGCCTCGGGTGGACCAATCGGGCGAGAGGTCGATGCAGCACCAAATACGGACGAGGTCGTCGCAGACCGGGG
AGAAGGAAGCGGGACCCTGAGCGGTGCAGCAGGGGCTTCGTCTCGAGGGTCAGGCGGGTCGTCAGGGTCGTCTTCGAGAC
TAGGCGGCGGTGGATTCCGTGGACCCGGAGGAGCATCTCCCGGAGGTATTGCAGGACCGGCGTTGCCCAGCCGCAGCGCA
GCCAAGAAGCCGCGCAAGGGCCTGGCGATTTACGACAACTACCGCATGGTGCGTCCGCCTAGCTCAAACTGGGACAAGAA
GACCCGGTACGAGGCAATCGGGCGGGCACGTGGCGCCGACTACGACGACGTGTTTGTGGTCAGCGCGCTGTTCCACCATC
TAGCCATTGTGCGGGTGCGAGTGCCGTTGCGGCTATTGGCCGTGCTGGACGGAGAGGAAAGCGAGGATGAGCTGGGAAAG
AGGAGCTGGGGCAAGCTGGAGGTGGTGCGTAGCCCGTGGTACGACTTTTTCAAGGCAGAGGACCGCGTGGCGGCGATGCA
GCTGACATGGGCCATGACGGCTTATCTGATGCGGAAACAGCCAGACGAGGAGGACGTCAAGATGGGAGAGGCGACGGCGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62