GenePrediction:GLEAN_4377 Details

Name: GLEAN_4377
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:259485..256239 (- strand)
Length: 3247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:259485..256854 (- strand)
Length: 2632
Type: CDS
Source: GLEAN
Position: GCSC_179:256786..256239 (- strand)
Length: 548
>GLEAN_4377 class=GenePrediction position=GCSC_179:259485..256239 (- strand)
ATGGATCGGCACACTGCCAACGGGTCCCGGTTCAAAGCAGTCGACGTTCCGCTGATCTCCACCCCTCCGCCGATCGACGG
ATTCGATGGCCGCCGTCCCCGGCCGCCCGGCCACATGCGCACAACGTCGGCTCAGTCCCGCAGCGTTGCCGACGAGTACG
CCTCTCTCAGTCCAGCCGAGGTTGCCGCCCGCCTGCAGACATCGCTGACCGGTGGCCTGACGCCGGCCGAGGGCGCCGCC
CGTCTCCGCAATGGCGCCAACGAGATCCCCCACGAGGCTCCCGAACCGCTCTGGCTGCGCTTTCTCGGCCAGTTCAAGGA
ACCGCTCATTCTGCTGCTGCTCGTCTCCGCTCTCGCTTCCGTTCTTGTCGGCAACACCAGCGACGCCCTCAGCATCACTG
TCGCCGTCACCATTGTTGTCACCGTCGGCTTCGTCCAGGAATACCGTTCTGAAAAGTCCATCGAGGCCCTCAACCATCTC
GTGCCCGACCATGCCCACCTCATTCGCAACACCGCCTCGTCCAGCTCCAACAGCTCCGCCTCCGCCTCCGCCTCCCCCTC
GCCCTCTACAGGCGGCGCCAAGGGCTCTGTCGACCCGGCCGACTTCTCCGACATCGAGTCCCCGCCCGAAGACGTCCTCG
AAGCCACATCGCAAAAGGTGCTCGCCGCCTCACTCGTACCCGGTGATCTCGTCTTGTTCAACACCGGCGACCGCATTCCC
GCCGACATCCGCGTCACCAAGGCCGTTGACCTGACCATTGACGCCTCCAACCTGACGGGCGAGAACGAACCTGTCCGGCT
GACTGCCGATGCCCGCCGCCGGTCTGTCCGGTCGCTCTCGCCCGGTCTCGGCCAGGCTCTCAGCAGCCTCTCGCTGCCCT
CACCGCCGCCCTTTGGCATCGACAAGGATGCCTCGCACGGCCAGGATGCCTCCAACATCGCCTACATGGGCACACTCGTC
AAGTCGGGCCACGGCCAGGGCATCGTCTTTGCTACCGGCGGAGACACCCATTTTGGCACCATCTCGCTCAGCGTGTCCGG
CACTGAGAGCCCGCGCTCGCCGCTGCAGATCTCCATGGACGAGCTCGGCGCCCAACTCAGCAAGTTCTCCTTTGTCGTCA
TCGGCCTCATCTCTCTCATCGGCTGGCTGCAGGGCAAGGACCTGCTCGAAATCTTCACCATCTCCGTCTCCCTGGCCGTG
GCTGCCATTCCCGAGGGTCTGCCCATCATTGTCACCGTCACCCTGGCGCTCGGCGTGCACCGCATGGCCGGCCGGAATGC
CATTGTGCGCAAGATGCCCAAGGTCGAGACCCTCGGCTCCGTCAACGTCGTGTGCACCGACAAGACTGGCACCCTCACGA
TGAACCACATGACGGCCACGCAGATGTGGTACTTTGGCCGCGACCGCCCGGTCGAGCTGCAAGCCGACGACGACTTTGCC
GAGACCAAGCCGGACGCGGCCACGCTCCGAATCCTGCGCATCGGCAACATTGCCAACAACGCGCGCGTGGCGCACAAATA
CCGAGACGGTGGCAGCGCAGCCGCGCGGGCGGTGCTGTCGTCGACGCAGCGTCAAGACGAACCGGCTCCTTCGGTCAGCC
GGTGGACCGGCCAGCCGACAGACGTGGCCATGCTAGACCTGCTGGACCGGTTTCGCGAGGACGACGTGCGCGAGGCCATC
GGGCCACGCACGGCCGAGACGCCCTTCAGCTCCGAGCGCAAATGGATGGGCGTGACCATTGGCACTGACAGCAACAGCAA
GGAGTTTGCGTACATCAAGGGCTCGCTGGACCGCGTGCTGGAGGCGTGCGACACGTATGTGGCCGGTGATGGGCGCGAGT
TCGTCCTGGACAGCAAGCAGAAGCAGAAGGCGCGTGACGAGGCCGAGAAGCTGGCGTCACAGGGACTGCGGGTGCTCGCG
TTTGCCAGCGGTGCCGTCAGTCGACCGAGCAAGAGACAGACCGGTGGCAGCACCGACGAGCCGTATCGCGGACTGACGTT
TGCCGGACTGGTCGGCATGAGCGATCCGCCGCGGCCAGGCGTCGGGCGGTCGATCCGCAAGCTGATGCATGGTGGTGTGC
GGGTGATTATGATCACGGGCGACGCCGAGACGACGGCCGTGGCCATTGGACGACAACTCGGCATGGCTATTGCCAAGTCG
ACTGAGCACACGGCCAGCCAGGTAGCCGTACGGCCGGTGTTGCGTGGCGAAGACGTCGAGGAGCTGTCGGAAGAGGACCT
CGCGCAGGCGATGCAGCAGACGACCGTTTTTGCGCGCACCAACCCCGACCACAAGATGAAGATCATCCGGGCGCTGCAGG
CGCGTGGCGACATTGTAGCCATGACCGGCGACGGGGTCAACGATGCGCCGGCGCTCAAGAAGGCCGACATTGGCATCGCC
ATGGGTCGTCACGGCACCGACGTGGCCAAGGAGGCCTCGGACATGATCCTGACCGACGACGACTTTTCCACCATCCTGCA
CGCCATCGAGGAGGGCAAGGGCATCTTCAACAACATCCAGAACTTCCTGACCTTCCAGCTGAGCACCAGCGCCGCGAGTC
TGTCGCTGGTCCTGCTCTGCACCTGTTTCGGGTTCAAGTCGCCACTGAACGCGATGCAGATCCTGTGGATTAGTGAGTTG
CCTGGCCTTCTCCCTCATTTCCCCTTCCCCCTTTTCCCATCGTCTCCTCTAACCGACAGACATCATAATGGATGGCCCGC
CTGCCCAGTCGCTCGGCGTTGAGGCCGTCGACCGCGACGTCATGAACCGGCCGCCGCGCAAGCGCAACGACGCGGTGCTG
ACTCGGGCGCTCATCCGGCGCGTCGCCCAGTCGGCCATCATTATCATGCTCGGCACCGTGCTGGTGTACCGCCACGAGAT
GCTCGAGGACGGCCTGGTGACGCGACGCGATACCACGATGACGTTCACGTGCTTTGTGCTCTTCGATATGTTCAACGCGC
TGACGTGTCGGTCCGAGTCCAAATCGGTGCTGCGCGGTGAAGTCGGCCTGTTCTCCAACGGGCTCTTCAACTGGGCCGTG
TCGCTGAGTCTCGTCGGCCAGCTGCTCGTCATCTACTTCCCCTGGCTGCAGGAGGTCTTCCAGACCGAGGCTCTGTATCT
GTCCGACCTGCTGAAGCTAGCCGTCCTGTGCAGCACCGTCTTCTGGGCCGACGAGTTCCGCAAGTGGTGGCGCTACGGCC
GGAACAAGCGCTTCGGCAGCAGCAGCGGATACAGTATGAGTGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62