GenePrediction:GLEAN_4378 Details

Name: GLEAN_4378
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:253753..251095 (- strand)
Length: 2659
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:253753..252452 (- strand)
Length: 1302
Type: CDS
Source: GLEAN
Position: GCSC_179:252393..251095 (- strand)
Length: 1299
>GLEAN_4378 class=GenePrediction position=GCSC_179:253753..251095 (- strand)
ATGAGCTCGACGGCGGCCAGTGGGCGGGGGGGCAAGAAGGGAGCCGGAGGCGACGTGGTGGTATCGGGCTGGTCATCGTT
TGGGACGGCAGCATCGGCGGCGGACGTGCGGGCCGTGCTGGCGGGACTGCACGAGCGCGAGGCAGCCCTGCGAAAGAAGC
TGCAGGCAGAGACGTCCGGAGGAATCAGCAGCAGCAACAGCAGCAGCAGCAGTGCGAGCGAGCGGCTCTCGCGTGACCTC
GTGCGTCTGGACGTGGAGCGAGCGACGGTGGGCGCGCAGGTGGTGGCAACGCGGACGATGGCGAGCAGTCAGCTGGGACG
AGCAGCCACGACGGCCGGCCGGCTCTCCTCGACCGTACGGCGGCTCGACCTCGAGAAGGCGCGGGTGGAGGCGACGCTGC
GGGTGGCCGAGCAGGTGGCGGAGCTGCGGGCCTGTGTGGCCGGCGTGGTCGGTTCGATGGGCGCGCCGCAGGACTGGGAG
GCCGCGGCCGGCTACCTGGCACGCGCCAGTCGAATCCCGGCAGCGATCGTGGCGAGCGGCTTCGCAGCAGCCGTGGTGCC
GTCGGTCGAGGTGCCGGATCCGCCAGCAGCCACGCTGGAACAGGCGCGGGCGAGCCTGTGCGGCCTCTTTTTGCGCGAGT
TTGAGCGTGCCGCGCACGACGGCGACGATGCCCGCGTGACGCGCTTCTTCAAGCTGTTCCCGCTGATCGGCCGCACCGAT
GTCGGGCTCGATGTCTACGGCCGCTACGTCTGCCAGGGTGTCGCGGCTGCAGCACGGACAGTGATGGGAACCGAAGCGGC
TTCCGCAACACCCTCGCCCTTCTTCTATCCCAACGCGCTCGCCAAGCTGTTCGCCCACATCTCGCAGATCGTCGAGGCCC
ACGGCGCCCTCGTGGAACGTCACTACGGCCCTGGCCAGATGGGCCGCGTCGTCGCCCGGCTCCAGAAGGAGGCCGACGTG
CAGGGCGGCATCATCATCGACGCCTGGGGCGACCGCTGCCATGTCGACCGCCGTCTGACCGACGCCAAGAGCTACCCCTT
CTCCTTCCTCGTCCAGAGCTTCCTCGCCCAGCAGCAACGTGGCAGTACCAGCACCACCAGCAACGGCAACACCGGCACCA
GTCTCGGCACCAGTCCCCGCATCGGCTCGCCTGCTGTGGCCGACGTTGACGGCGTCAGCCCCCGCCAGAGCGAGGACGAG
GGCGGCGTGAACATGAAGGAGGTCGACGGGCTGCTGAGCGAGATCGCCGTCATGCTGGGACGGTGGTCGCTGTACTCGCG
CTTTCTAGCGATGAAGAGCAGGGTGCGTGTGTGTGTTTACTGCTTTACGTCTTTTTGGTTTCCCTCTCTAACTACCCAAG
CCTCCTGATGACACCTCCGACTTTCCTCCTCTGCCTCCCGTCATCGCCCAGTCGGTCCTCCAGCGCAAGGTCGCCGCCCG
CCTCATCACGCCCTACAACCTCCTCAGCACCTTCTTCTTCCGCCGCTCGGTCGAGAAGGCCTTCCAGCTCGAGGAAATGC
CGGCCGGCCTGACCCTCAGCATGGCCCGTCCGCTCGACAACACCAACGCGCCCTACATCATCTCGGCCGTCGACGACGTC
ATGTACATTGTCAGCGCCGTCATCCAAAAGGCCGTTTCGACGCTGCAGCGTGACGTCGTCGTCGGCGTCGTCCCGCCCGT
CGGCCGCGTCCTGGGCTCCGACTTTATCGGCATGGTCCAGCGCAAGATGCGCGACGAGGCCTATCCAAAGCCGGCTGTCT
CGGGTGGCTTCCCGCCCGAGGACAAGATCATCGCCTTTGTCGTGCTGATTAACAGCCTCGACCTAGCCGTCGAGTATCTG
GCCCGCATCGTGTCGGCGCGCATGGGCGTGACTCCGGAGGAAGGCGGGCCCACGACGGCCGCCGAGGGCGGCACCACCGG
CAGCGCAGCCGTCGCAGCCGGTGGACCACCGCCCGCCGTCCCGAGTCCGACTGCCCCCGCCGTCCTGGCCTTTCTGCGCG
AGTCGTTCTCGTTCGCGCACGAGGCTGCCGCCGTGGCCGCCGCCCTGGCCGGCCTGCACGCGTCCTTTGCCACCACCGCG
GCCGAGCTGCTCGGCGAGGGCCTCCAGGTGCTCTTCGGCCAGGTCGCCAAGGCTCGGCTGCGTCCCGTCTTGGCCGACAC
GTTTCGCGATGCCGACTATGGACTCGCCGAGGCCGACTTTCTCGAGCTCGCCGACGCCAACGACGAGGACGTCGATTTGC
TGCTCGAGCTCGTTCCCCGCCGCTTCGCTCATGGCTGGGATGCGCTCATGCGCCCGCTCGCCCGCATCATGACCCCCCGC
ACCTACGCCGGTCTCGCCGACCAGGCCGCTCGCTACCTTGCCCGCGTCCTCGAGAAGCGCGTCTGGGGCTATGTCGGCCG
CGCCAGCCCCCATGGTGCCATTCGCCTCGAGCGCGACCTCAACGGTATCGTCGCCGCTGTCGCCCGCGGCAATTACGGCG
CCCGCGAGCTCTTCGCCAAGACCACCCAGATCCTCATGGTCGCCAACATGGACGACGACGAGTGGGACGAGCTCGGCGGC
GGCGCTACCGCCGCTGATGCCGACGACGATGACGACATCGTCTGGCTGCTGTCCGACGACGAGCGCCGCCGCGCCCGGAA
CTTGGTGAAGCGTGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62