GenePrediction:GLEAN_4379 Details

Name: GLEAN_4379
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:243424..240539 (- strand)
Length: 2886
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:243424..242624 (- strand)
Length: 801
Type: CDS
Source: GLEAN
Position: GCSC_179:242563..242275 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_179:242199..240539 (- strand)
Length: 1661
>GLEAN_4379 class=GenePrediction position=GCSC_179:243424..240539 (- strand)
ATGTATTCGCATTCTGTGCCCTTGAGTCTACCACGAACTATCCTTCGCTTCTCTCCGTCGACGAGGTCCAGCCAAGCCTG
GCGCATCCCCCATTCGCTGTCTCTTGATCGAACCGAGCTCAACTCAGCCGGCAACACTGGACGATCAGTCGCCACCTTTC
CCAGTGGTCTGCAGACGCCCCCAGGCGACTGTGACAACGGTGCTATGGGTACTACCTACCAACCCCCATTGGCAGGCTAC
GATGACCGACACGGCCCGGCATATCCTGCCTCTTACTCCTCCAAGCTGCTCTCCGACGCCGACCGGAAACGCACGATCCT
GAGCGACCTCACAAACTCCGCAGCAATCGGCAATGGTCGGAGCAACAGCAGCAACAGCTTCAGAACCGACAGCACCTATA
CCATAGATCACGAGCAGTACGCTGGCGCCGTATCGACAATGCCCCAACCGCTACAGCCTCAGGGCTACGGTCAGCCCCAG
ACCCTCTTTACCCAGCAACGGCTGCTGCAGAAACAGGCAGACAGTGCCGTTCTCCCTGGACCCAGCCTAGCTCTGCCGCC
CGTGACTTCGGCATCGGCTCGAGATAGCTCTCAGACAGCACTGGCAGCCCATGCCTTCTCCGGCTATCCGGCTCGTCCAT
TAACACCAACCAGCTCGAAGTCTGCTATTCCGTCACACCCGGCGGGCCGTTCGCCCATCACCATCTCAGATCAAGATTCT
GCTTGCATGGTGATGCACAGTTTAGAGGTTCCCAAGTGCATCAGCCCCGCTGGAGGGAACTTGGCAGCTTTCACCGCAGA
GGTAAATCGAGTCCGACCCCCCCTTTGCCCACTGGCTGCCTTGCCTGCTAACGCCACACAGTTGACGTGTCTGTTTTGGT
TCGAATCCCCGGTTGTATACCAACTAGCCGACAATATGGAAATGATTCCTCAGGAAGTGTGGATCCCGCGGATCTGCGCA
AACGCCATTCCGAACCCGAGCTTCAAGGCGTGGGTCAGCCGGATTCTCACGACGACACAGGTGACGCAAAATGTGGTCTT
CCTGGCCCTGCTCTTCATCTACCGGCTGAAGTCGTTGAACCCGATGGTGCGAGGCAAACCAGGCAGCGAGTTCCGCCTTC
TGACGGTGGCTCTGATGCTGGGCAACAAATGTGAGCAGACGACGGTGCCTCTGGCAACAGTCCGCGTAGGCTTGGCTTGG
CTTGGCTAACACGAGAACTGTGCAGTTTTGGACGACAATACCTATACCAACAAGACATGGTCAGATGTGTCTACCCTGAA
CGTCAAGGACATCCATGTTATGGAGGTGGAGTTTCTGAGCAACATGCGCTACAGTCTACTGGTGTCTGCAACCGAATGGA
AGGAATGGTTGGTCAAGCTAGCCAAGTTCCGCATATACTACGAACGCGCATCTACAACGTCAGCAGTATCGCCCCACTCT
GCCGCCTCACCCCAGCGGCCAATTGCGTCTCCTGCCGCGTCTCCGACTGGGGCCCAGCAGAGCGTGCACAGCTTCGGCAC
CGGATCGGGCGTGCCTCCGATGTATGACTCCTCGAGCTGTTCTCCGACTGCCCGGCCGTTCTACGCGAGCAGCAACACGG
AGATGGCACCGCAGCAGTCGTGGCCGGTGCCATATGCAAGCACGCAGGCTGTCTCTCCGCTGGCAATGAAGTCGGACATG
AACGCATTCGGCAAGAGGTCGCATGCCCATGATGACCCCACGGAGCCACCGCCAAAGCGGCTTGTCCGGCCCGGTCTACC
GCCAACGGTCACGTCTCTCGGGTCCGTTATGCCAATGTCGAGCCAGGCGACCGATCCATTCAGCACCATGGCGTCGACTG
GATCAAGCGGGCCTGTGGCCGAGACCATGCGGCTGCCGGTGCCTCACCTGACGCTCAACACAAACACAGCACAGACGCAG
ATACCTGGCCCGGGATCGGCTATCGGGTCATACCAGCCGGCACAGAGCAACCTGTCACTGCCACCGCTCGCGCATGGCAT
GCGTGCTATGGCGACGGTGTATCCTTCGAACAGCGGAGCGATCTCGACATCTGTCGGAGCGGGAGTCGGTGCATTGCCTG
CTCCGTCGACAGTGAACGGCGTGGCGGGCGGGGCGTCCTTCCCGGCCAAGCTTTCCATGATGACGACGGCAGGCTCAAGC
GTAGCTGTGCCGCCGGCGACGACACTCGGCGTTACGGGCGGGTCGACACCTACGGCGTATGCGGCGCCTTCGTTTGGGAC
GCCGACCAAGCGGATGAGCCCGCTGAATGCTCTGACGCCGAGCGTGGCCTCTGTGTATGCTGCGGCACCGACGTCGTCGC
CGCTCACGGACAGCTTTCCGCACATGGCGTCGGCACACACGCCGATCTCGCACTCACCGTCAATCTACCTGCAGCAGCGG
GCGAGTCCGTACCGTCCGATCCGCAATGTGCATATGCTGCTAAATCCTCCGCCATCGTCGAGTCTGCAGGAATACCAGGC
CAACGGTGCGCTGCTGATTCCGCCGACGCAGATGTACTACCAGCCACTGGGACGGCGAAACGATCTGCGGTCGGGGATTG
TGCCGGAGTTCCAGGGGCTATCATATGGGGGATCGGCGATGCGGCAGGGACTGGCTCTGACTCCAGCCCAGGCGCTGCAA
CAGCAAGCAATGCAGCACTTGCAGCCGATGCATTCGATGCACTCGATGCAACCGATGCAGTCTATGCAACCGATACAGCC
AATGCAGTCGATGTCGATGCAACCAATGCAGTCGATGCAGCCGTTGCAGATGCACTTCCGAGAGGTGCGAGGCCAGCCTG
TTCAGCATCTCCAGGCACAAGCACAAGGCTACGCACCTCAGCAGCCGCACCCGACGCAATACGGGCATAATTCCTATTCG
AACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62