GenePrediction:GLEAN_4381 Details

Name: GLEAN_4381
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:235194..233551 (- strand)
Length: 1644
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:235194..235122 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_179:235059..234098 (- strand)
Length: 962
Type: CDS
Source: GLEAN
Position: GCSC_179:234044..233743 (- strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_179:233572..233551 (- strand)
Length: 22
>GLEAN_4381 class=GenePrediction position=GCSC_179:235194..233551 (- strand)
ATGAGGCTCTCGACGCTTGTGTTTGGCCTTCTGGCCGTCGTCGCTCCCGTCATGGCCTCCTGGTCGAAAGAAGGTATGTC
CGTGTGGTCGTTCCCATTGTCGGTCGTCTGTCCGTCCGCTCACGCCCGTGGCCAGACCAGGAGATCTTCCGTGTGCGGGA
CGAGCTGGCCGGGGCTCTTGGCGCCGACGTCAGCTTTTACGACTTTGTCGGCGTGGCCGCCTCGGCCTCCGTGGACGAGA
TCAACAAGGCGTACCGCAAGCGGTCCCGCTCGCTACACCCGGACAAGGTGAAGCAGCAGCTGGCCGCCGAGCTGGCCGGC
AAGACCAAGAAACACGCCGCCGCCGGAAGCGGAAGCGCGGCCAAGCCCAAGGGACCCTCGGCTGCCGAAGTCCGCGCTGC
CATCAAGAAGGCCTCGGACATGCAGGCGCGCCTCAGCATCGTGGCCAACATCCTGCGCGGCTCTGGGCGTGACCGCTACG
ACCACTTCTTGGCCAACGGCTTCCCCGTCTGGAAGGGCACGGGCTACTACTACAACCGCTACCGTCCCGGCTTCGGCACC
GTCCTCTTCGGCCTCTTCGTCTTTGTCGGCGGTGCTGCTCACTACGTCGCCCTGTATACCGGCTGGAAGCGCCAGCGCGA
TTTTATGGATCGCTACGTCCGGCATGCCCGCCGCAGCGCCTGGGGCGACAGCCTGGGTTTGGATCTCAGCTCCGCTGCTG
TAGCTACTGCTGCTGCTTCTGCGGCTGCTCCTGTCCCCGAAGACGATGCCGCCCCCGCGGCTGCCCTCAACCGCAAGCAG
CGCCGCATGCAGGAGCGCGAGTCCAGGCGCGAGGACCAGCGCGGCGGCACCGCCAGCTCCGGCCGTCGCAGCGTCGTCGC
CCGCAAGACCGGTCGCTCCACAGCTGCCGCCACCGCTTCGGCTTCGGCTCACGCTAGCGGTACCGCCACGCCCGTCACTT
CGCCCACCGGCGGACCGACTGGGGTCAAGAAGCGCGTCGTGGCCCAGAACGGCAAGGTCCTGGTCGTCGACTCGCTCGGC
GACGTGTATCTCGAGCAGGTCGACGACGACGGCAACGTGGAAGAACTGCTGCTCGATGTAAGCAAACTGCCCCCCCAAAC
AAACAGATAAAGCTGTTCTAACTCTGCTAGATCAACTCCATCCACCCTCCCACCTTCCGGGACACGGCCGTGTACCGGTT
GCCGGCCTGGCTGTACGTCCTGACCGTCGGTCGAGTACTTTCCGGCAAGCAGGAAAGCAGTAGCTACAAGCCAATTGCTG
CGGCTGACGACGAGAACGATGTGGACGACGAGGCTTCGTCCGCCGGCAAGGAGACCCCCAGCACCGACTCCAACGAGGAG
TTTGAGCTCCTCGGCACGTCCACCGAGTCGCTGGGCCGCGCCCGCGTCTCGGGCAGCAACAACGGCAAGGCCGTCAGACG
CAAGGGCAAGCGGTAAGCCTCGACGCCATCTGACCTTTTGGGCAACACAGAAAAGCCAGATCCGAAAGGGACGCCCTGAC
AAGGACGGCCGCAAGCAAACATTCGTCTAGCATCAAGGATCTAAAAATCATAGTGTACGCTAGAATTGCTACTGGTGTGT
GCTTGCACGTGTTGGCCTATAGCTTCTATGATATTGGCACTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62