GenePrediction:GLEAN_4382 Details

Name: GLEAN_4382
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:231414..230601 (- strand)
Length: 814
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:231414..231387 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_179:231333..231273 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_179:231204..230601 (- strand)
Length: 604
>GLEAN_4382 class=GenePrediction position=GCSC_179:231414..230601 (- strand)
ATGGCACGGGCAGCTCCGCCAGACTATTGTGAGCCGACCCTGTTTGGGTGGACTGGATCACGTTGCTCATCACGACCACA
GATGCCGTTCTCGAGGTGTCGGACAAGGCAACCGCCCAGCAGATCCGCGATGCCTACAAGCGGTGAGTCTGTACGAGCAG
TGGTGTGGACGGGGCGACCTGGTCGACGATGCTGATTCTGTGTTGGGCAGTGCCGCCCTAAAGTCCCACCCCGACCGCGT
GCCTGCCGACAGCCCGGAGCGCAAGCGGCGCACGGAGCGCTTCCAGCTGGTCAACGACGCCTACTACGCGCTCTCGGACG
CCGGCCGGCGCCAGGAGTACGACACGCAGCGGCGGCTGTATGGCGTGCGCGACAACGGCCGCGGCGGCGGGGCCTCGTGG
GCCTGGGATCATTTCCCGCAGCCGGCGACGGGCAGCGATGGGCGCCAGGCGAGCCCGGAGGAGGCGCGGCAGCGCACGGA
GGAAGCCCAGTTCGCCGACGTCTTCGAGGAGATGATGCGCGAGGAGGGCATGGCCGAGCAAGAGGACGCCAACGGCGGCG
GCAGCACCAGCACCGGGTCGACTGGGAACATCTGGGGCGTGCTGGGCGGCATTAGCGGCGGCGCCCTCGGCTTCATCGTG
GCCAACGTACCCGGGATGATGGCCGGTGCCGTGGCCGGAAACCGGCTGGGCGCCATCCGCGACACCAAGGGCAAGAGCGT
CTACGCCGTCTTCCAGGAGCTGCCGTCTGACGATCGGGCTCGCCTGCTCAGCCAGCTGGCTATGCGCGTGCTCAGTCACA
CGGTGGGTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62