GenePrediction:GLEAN_4385 Details

Name: GLEAN_4385
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:221813..216093 (- strand)
Length: 5721
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:221813..221447 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_179:221376..220662 (- strand)
Length: 715
Type: CDS
Source: GLEAN
Position: GCSC_179:218947..218713 (- strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_179:218635..218430 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_179:218367..216093 (- strand)
Length: 2275
>GLEAN_4385 class=GenePrediction position=GCSC_179:221813..216093 (- strand)
ATGGGCCTGTTCTCGCTCGTGCGCGACGACCGCGCCATGCTGGTCGGTCTCGGCATCGCGTCGGTCGGCATCTTTGTGGG
CATGCGGGCGGTGCTGCTGCGCTTCCGCGACTCCAGCGAGATCAAGCCGATTCAGCCGAAGCTACGCTACATCACGCAAG
AGACCGAGGACGCGCTACCGGCGGCGACGCTGGGACGCCTGCTGGGCCACTACAACTACTCCATCCGCGAGACGACGGCC
AAGATTGTGTGCGACCGCGCCGTCAATGACCCGCTGACCCTGCAGCTGCTGCTCTGGGGCATCACGCGCGACAGCTACGA
GGAGCGCATGAAGAACCTACGGGCCCTGGCGATGCTGACCGATCTAGGTGCGTTTCACTTATCGCTTGTCCCTCTCTGTC
CTTCTGGTCTCTCGCTCATCTAGCTCCTCCCCCCCAGACAGCCTACACCTGCTCGACACGCCGACGGCCTACTCGGCCTT
TGTCCGGTCGCTGCAGCTCTGCGTCGGCGAGACCCAGTACGACATGATCGACGACGACTTTTTCGACGAGTACTATCTGC
GCGACATTGCCGAGAAGCTCTGCCTCATGTTCGTCGACCAGCTGGTCCACAAGTGCAAGCACGGCGTCGACCGCCTCGTC
CACGCCGGCTTCGTCGACCGCTGGCTGGCCAAACAGCGCTGGGGCACCACCGACGACCAGCGCATCGACAACTTTGACCG
CTACCTGCGCTTCCGCGGCAACCGCATCGCTGACATCTGCAAGCGCCTCTACCACTCGCCCGCCGGCTACGCCGCCCTCG
AGCGCGCCCGTCTGGTCCGGCCGCACAGCCACCGCCACCACCGCCACTACCGGCTGTACGACTGTCCGCTCGAGGTGCCG
GGGGAGAGGGAGACGGTCGAGAGGCATCCAGTGCAAACCCGCCCAGAGCCTTTGACCGATCAGGAACGACGCGCAGACAC
ATCCAGCCAGGACGACTCCCCACCCGCGGACGACGAGTCCCAGACGCACGATGCGGCGTCGGCGCAGACTCGGCAGCACG
GCCAGAACACGCAGGAAGGACAGCGGATCCGGCGGCAGCACCGCGAGGCCATGGTGCTCAACGACGGCACGCGGCCGCTG
AGGCGCGACGACATCTTTGAGCGTGAGAGCGAGTGAGCGGCCGTGAGAGGAGCGGCTGGCCGTCACGTGCAAACGGGGCA
GGTTGCTGTTGAATCTGACGTGTGTTGTTGTAAAGCGATGGCGATGTAGATACGAACCATGGCAGCTCCACCGGGACCAT
GCAGGGGTTCTCTGCAGGACGGCGGGGCTGCACGAAAAGGACGCCTCTCCCTGTGGACGGAGCTGCACGAAAGGCCACTG
TCTGCTGTTCGGACGCCTCTCCCTGCGGACGGATCATGCACGCAATCCGTCGTCGGGGCGACAGGGCCCTGATGAACCGG
CGTCAGCGGCCAGAGATGGCGGGCGCCGTGGCGGTGAGCCGCAGTGTGCTGCAGAGTTGCCACAGCGACTGTGGTTGGTG
CTGCCGTCGGGACATTCGATCTAGCCATCTTATAGGAGATTTTAGTAGCTAGTTTTGCTCACTACGGAGTACTGACCAGT
AGTAAGGCATCCTACCTTACTGTTACATAGTCTGTACCATTGTACGATACTCCATACGAAATACTCCGTACCCAATCGTA
TGCTACAATACGAGCCACGAATTCTCTGAACCAATCCTGTCTATGTATCTTATGTACCGGTAAAAAAGGACAGCAGTACA
GATAACACCGGCCAGACGGATACGCCAGAAAGCACGCCCGCACATACCTGCATGCGCTTGCAGGCCCGCCGCAGCGTCAG
CTGGGCCCGCCGCGATGTGGCGGACCTCTTCATGCGACATCCTGCGACAAGACGAACGGGATCGTCAGGTCCTGGCGTCG
CAACGAGTAGAGAGCAGAGCTGGACGATTACGGAGTATCTGCCAATGGCACCTTCCTACAACCAAGACTAGAAAACCAGC
ATGACCTGCTCCTTCCCTCTCTCTGTCCGCGCCCCTCCTTTTCAGGCTTCCCCCCTTTCCCAAGTTGCCCTTTCCTAAAG
CGACTACTACGTATATCGGCTTGTATCTTAATACTATCTAATATCGCTCTGCATGTTGCATTGTCACCTTCCATCTACTC
CGTACATACTTCATACTCTCCCATCCTTTCTCTTCCCCCTTCTTCTTCGTCTTTTTCGGTTTCCCTGTTTCCCTTTGCTG
TTTCCCTCCCTCTCTGCGCAGTGTGCCACCGCCTGCACACGCATCCGCTCGCCCTGTCGATCCCTCTCTCTCTTGTCGCA
AGCCGGCCGAAAGGCTTCTTTTGATCCTTATAAGCTGGACGCTGTTACGTGCAGCACTCTGCATCTTCAGTTCGCCAACC
GTCCGCCGCCCTCGAACGCGGCCTTCCATCGCAGCCATCGACGCCGAACGCCGAACGCCAACCGTCAGCCGTCAGCCGTC
AGCCATCTCCCCTGCAGCTTCTCAACGGCTCTGTCCCCCAACCACAGACCCCCTAGTCATTGCCACTAGCGCACGCTAAA
GGGGAACGCACCGCTAAATTACGCCCTACGCTGCACGCTGCACGCTGGCTTGGCCTCTGGGCGCCTGAACCCGCGCTGCC
GCATCTTTGGGCCTGTTGGGTCCCGAATTAGCAGCCTGTCCATTTAAATTAAATCCGCCCTTTTTTTCTCGCCTCTGTCC
GCCGTCATGTCTCCCACAACAACAACAACATCCACCACCGCCACCACCGTCACCACCGCTGCCACTGCTACCGCTCCCGC
TCCTGACTCCGCCCCTATTGCTGTATCGTCGGCGCCGTCACGCTCCATCCCCCGGTCTCTGCGCAGCAAGCGGCTTCCGA
CCTCTTCTCGCGGCTCCGGCATCTCTTCCGTCTCGACACCGAATCTCGGCTCTCTCTTCGCTTCCCACGCGCGCCTGGGC
CAGGCCCAACCTCCACCACCCCTGCCCCCGGTGCCGCCTCCGCTGCTCATCCGCAAAGCTTCGGTCGCTGCCCTGACCTC
GTCCTCGCTGGCCACCATCCCCGATGACACCGAGTTCTACGCCTTTGACACTCTGAACGAAGTTCCCTCCTCCGCCTTTG
GCTCCAAACACGCCTCGCCGTCTCCGTCGCTCGGCATGGCTCCCCTGACCCCCAGCAGCCGCTTTGGCGCCTCTCTCTGG
GCCCGGGCTCATCTCTGCCCACCGGCCCCGACGTTGCTGTCGGCGATGCTGTCGATGTGCCTGGTGGCCTGACCGGCGTC
GTACGCTTTGTTGGCTCTGTTGCTGGCCGCAGAGGCGTCTTTGCAGGCGTCGAGCTGCACTCCGAATATGCATCTCGCGG
CAAGAACAGCGGCGACGTAGATGGGTAAGCTCAGGTCTCTGTTTTCCGTCTCTGTTCTGTACTGTCTCTGCTCTCTAACC
AGTCAGCATTTCCTACTTTTCCACTGCCACACCTGGTGCCGGCATCTTCCTTCCCGTCTCCAAGGCCCAGCGCCGTGACT
CGACTGTTGGGCCGCTATCTCCCACCGCCAGTGGCATCGGCCTGAAGCTAGGGAACCAGAACTCCACAAACTACACCCCA
CCCACGCCGTCACTGTCGAAATTCAGCCAGTCTATGAGCGCTGCCAGTGCTTCCCGCGCCTCCAGTCCCCAGGGCAAGCG
TCCGTCGCTCCGAACATCTCTGTCGCGGCCTGAATCTCCTGTTCGCCGCATGCAGATGACACCAGTCCCACAGCGGCCGT
CCATCACGCCTGCGCCCGGGCGCTTTGCCAGCCCAACAAATAAGTTCTCCCAGAGCCTGCGAGCCCCATCGGCCGCCGGC
GTGGGAGATCCCAGCAAGAGAGGCCTCTCCCTTCGACCCGATTACTCCAACAGCATTGGTCCGCGCAGCGTCTCGGCCCT
GGGCGCTGCGTCGGTGTCCAGCTTCGACGATGACGTACCTCCCATGGGTCTAGGACGCACGAGGGTGAATGGTGCCGGTG
GCAGCGGCAGCGCAAACGGTCCGATTTTCGAACAGAGGGAGCGGTCTCCGTCCCACACACTGAGGTCCCCGTCTCGTGCA
ATGCGGCCGCCATCCCGCGCGAGCAATGCCAACTACGGAAGTCCGGTCGCACCCACGGCTATGGACGCCGAGCTGGAGCG
GCTGCGTGCCGAGCTCGAAGACCGGGAGCGCCAGCTCAAGGAACAAGCAAACACGCTTGCCGATATGGAGAGCAGCCTGA
CCGAATTGCAGACACTGATGGACAGCCCAGACGGGCCTATGGGCACTGGTGGCGGCGGCGACGGCGGCGTCACCAACAAC
CGCCGCGACAGTGTCGACGACAAGGATACAGCGCAGCTGCGCGCTCTTCTGCGTGAGAGGAACGAGAAGATCGCGATGCT
GACGGCCGAGTTTGATACACATCGGGCCGATTTCCGCAGTACTATCGACACTCTGGAGATGGCCAGCACCGAGACAGAGC
GAGTGTACGAGAAGAAGATTGAGGACCTGATGCAGGAGATCCATGAGCTAGAGAGCCGCACGACCGACGTGGATGCGGTG
GCCCAGCAGTTGAAGCAGCTGGAAGAGCTCGTGCAGGAGCTAGAGGAGGGCCTAGAGGACGCCCGTCGTGGCGAGGCCGA
GGCGCGAGGAGAGGTCGAGTTCCTCCGCGGTGAGGTTGAGCGGACACGGACAGAGCTGCGACGCGAACGCGAGAAGCTGG
CGAACGGCAACGGCAACAGCAACGGCCATGCGGCTGCGCCGGGATCGATGCAGACGTCGAAGGAGCTGGAGCAAAAGGAC
GACGAGATCCGTGGTCTCAAGGCGATCATCCACTCGCTGAGCCGGAACGCAGGCGCCGAGCTGACGGAGAAGGACAGCGG
TGCCGTACCTGGCTCCCCGTCGAAGCACCGACGCGGTGAGTCGATCAACGAACGCATGGCGCGCGAGAAACTGGAGCGCG
AGGTGTCGGACCTGCATGTGCTGCTAGAGAGGAAGTCGGCACGGGAGACGGAGATGGAGCTGGAGCTGGAGCAGCTGCGA
CTCGGAGGTGGAGCTGCACCCACGAGCAGCCAGACGCACCACATCAGGATGAAGACGGCCAGCAGCCGGTCATCACTGCG
CGACTCGCGCGACACGATGGTGCTCCCGCGCGAGCTCCACGAGACGACAGCCGGCGGCGGCGGCAGCAGGTCGCCGGATT
TGGTGCGCAAGGTGCATCATGCCCGGGGTGCGACGCTGGACACGATGCCCGAGAGCGATGCCTACTCGTCTGTGACGGAT
GCGAGCACTTTGTGGTGCGAGATCTGTGAGGCCAACGGTCACGACATCCTGACGTGCACCAACATGTTTGGGCCGCAGAA
CCAGCAGAACCAGCAGAATCAACAAAGCCAGCAGCAGCAACAGGCACCGCAGCAGGAGACCACACCAGACCCGTCCGTCT
CCTCGGATATCCGCACCGGCAAGGACCAGAGCCCAACCGAAACAGAGCCGACGGTCGAGACTAACGGCCACGAGCCGTCG
CCACTGGTCGCCCCGCTATCGCCTGCCCGGACGACAACGCCGACGGCAGTGCCGGCCGAGGTCAAGATTTTGCCCAACCC
CTTGGAGTCGGGTCCCGTGGCCGGCAAGGAGAGCGGCATGATCGACACTGACAAGTGGTGCGCGCTGTGCGAGCGTGACG
GCCACGACAGCGTGGACTGCCCTTTTGAGGATGCCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62