GenePrediction:GLEAN_4386 Details

Name: GLEAN_4386
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:215371..211769 (- strand)
Length: 3603
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:215371..214240 (- strand)
Length: 1132
Type: CDS
Source: GLEAN
Position: GCSC_179:214173..213750 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_179:213677..211769 (- strand)
Length: 1909
>GLEAN_4386 class=GenePrediction position=GCSC_179:215371..211769 (- strand)
ATGGGAAAGCGAAAGCGGTCCGGAAAGGCGGCGGCGGCAGCGGCCAGTAGCGGCAGCTCACATCCGCCTCTGGCCAAGCG
GCCCCGCGTCGACTCTTCCGGCGAAGCTGTGCTGGAGAAGGAGATTCGTCCGGGCAGCGGCAATGCTGACGAGGCCGAGA
AGGACGCGCTGTTGGCTGATCGCTCAGTCTTTGCGGCCGATCTCTCGCGCGCCGACCACGACCGCGAACGCCGCCTCTAC
AAGCTGCTGGGCAGCCCCGACATGGACGACCGCTTGCGTGCGGCCGACGTCATCGTGTCCGCTCTCGCCGGCGTGTCCGA
GCCCGTTCTCCTGCGCCACATTGAGCGTCGTCTGATGCGCGGCCTTGCCAGCGGTAGTGAGGCCTCACGCATCGGCTTCA
GCTATGTGCTGTCGGAGCTGCTGGGACAACTGCTCGGCAGCAGCAGCAGCAGCACGGATGCATATCCCAACCTGACATTT
GACCGGCTACTCGACCTGCTTCTCGAAAAGACCCGTCCTGGGACCAACGTTCCCGGCCAGGAAGAGCGCGATCACTACTG
GGGCCAGCTGTTCGGCCTGCAGAGCTTCGTCGAGTCGGGGGCACTGTTCGGCAGCGGCTCGTCTGGCCGCTGGGATCGCG
TGCTGCGCTGTCTGCTGCAGCTCGGCCAGAAAAAGATCTGGCTGCGGCCTCAGGCCTGCTTCGTCGTCGTCCAGGCCATC
CGGCGCAGCCACCTGCCCGACCAGGCCGCCGTTGTCGCCACCCTGGAGTCCATTGCCCGTGGCGGCGAGGGCGAGACGGC
CGGCCACTCCGACCTCCCTTCCGATCTGGCCAAGACGCCAGAGGGCCTCGGCATCTGGCTGGCTGCCCTCGAGCGTTTCC
CCGATATGGCGTTGCCGGCGCCCTGGAAGACGCCGCTGGCACCAGGCGCACATCGGGAGCTTGTAGCCGTGCTGCGCAGC
AGCGGCGCCAGTGGCGGCGGCGATGGCGACGAGCCCAAAACCGCAAAGCAGACGGCCGCAAAGCAAGGCAACGCATCGGC
CCAGCTGCACTTTGTGTGGGACCTTCTGCTGCAGGCAACTCTGCGCCAGGCACCCAAGCAGTTTGACGCTTTTTGGGTGG
CCGTGGTGGACCGTAAGTTTCTGTTTCTCTCCGTTCTTCTGCTTCTTCTGTTCATCTTCCCCTTGCTGATCCGTCCAGAG
GTGTACTTCCCCAAGGGAGCATCCGACCACCAGAAGCTCACGGGCTTCAAGGTCTTCCAGCGAGCGCTCTCTCTGTGTGC
TGACGCCGGCGACATGCGTCCCGTCTTGTTCAGCAGCAATCTCGTTGCCTGTCTGGTCAACCAGGCGTCTCACACCACGC
CGCGGCTGCACCGTGCCGCCGTCCAGGTGCTGCGTGCCATTGAGTGCCAGGTGGAGGACCGTCCGGCCGTGCTTGTGTCT
GTGGTCGCCGCGCTGCTGGGCTGTGTTCCTGGGGCACATGGTTTCTTTGATCTGGATGAGCGCGTCAAGGGCACCGGTGA
CGGCACAAAGCCCGTAGAACGCATCCTGCGCTTTGTCGGCGTTGACGCTGTTGACGAGGTCGTCCACACGTTGCGTGAAG
GTGCTTTGCGGGCACCAGATGCGTGAGCCATCCCCTGTCTATCTCCCTCTCTCCGCCACTCGTCTGCATCCCGATGCTAA
TGTCTGCGTCGCAGAAATGCCGACCAAAAGCCGCTTCGTATCTATGCAGAGTATCTGTTCCGTCTGGTCAGCCGGACAAA
CAACAGCACGGCTACCGACAACGACTCGGATGAAGGCCATGAGGATGGCCACGTGTCTGTCGGCGGTGTCGCATTCCAAT
CCCTTGCCGAGATTGCCTATCCGAGCAGCAAGACCAAGCTGGTAAAGAAGGCATCCAACTTCTCTTCCTCTTCTTCTTCC
TCTCCCGCTCCTCTGCCCAGCCTCAACGAGAAGACACAGACGGCCAGCCGCACGTACCTTTTGTCAGCCGCCGGCGCCCT
GCTGAAGAAGACGGACGACTTTACTAGCTTTTGCCGCACTGTCCTCTCCATCGAGCCCGCGGCGGCCGGGTCTGCCATGA
GCGACGAGATTCAGGCGCAGGTCATCGATGTGAGGCAGCAGCTAAAACTCTTGCTGCGGGATGACGGAGACAAGACGACA
GCGGCCAGCGCCCGGGCCCGTCAAGGTCTGGCCGTGTTGCTCTCTGTATCTCTGCTCCAGCTATACCACGAGCCGCGACC
TGACGCGCTCGAAGTGCTGCAGGACATCAAGGCTTGTGGCGACAAGTTGGCAGCCCTGGAGAGCAGCCAGGCAGAGGCCA
AGAAGAAGGCCAAGAAGGCGAAGAAGGACAAGACGGACACCAACGATGCGACTGCTGACGAACCCGACATTGGCGAGGTC
CTCATCGAGGTTCTTCTGGCCATGCTGGCCGACTCGTCGCAGCTGACACGCCAGGCGTCGCTGCAGGTCTTTGAGGCCTT
TGCTCCGTACATGTCGGCCCGCGCGCTCGACAATCTGACTGAGGTGTTGGTGGCCGAGGAGAACACGTCTGGCTACCGGG
CTCTCTTCAACCAGGAGGGTGAGGATGACGAAGACGAGGACGAAGACGGAGACGACAGCGATATCGAGATGGACAGCGAT
GTCGAGATCACGCAAGTTGGGGCGGGCGAAGACAGCGCATCGGACGACAGCGATGACGAGTCTTCGGACTCGGACTCGGG
TTCTTCTGATAGTGACAGCGAGAGCGAGAGTGATGGTGATGATGACGACGACGACGACAACGGCAATGACGGCAAGACGA
AAGCGGCTGAGGCCGAGGCCAACGCGCTGGAAGTGGCGCTGATGAAGACGTTCAAGACCAAGAAGCTCGCGCTCGGCAAG
GTCCAGGACGATGACGGTGACGACAGCGACTCGTCGGCCGAGTCGGACATGAGCGACGACGCGATGCTGGCTCTCGACGG
CCATCTGGCCGGCCACATGAAGCTGATCAAGAGCAGGACCGAGGGTCGCAAGAAGGAGCGCGACGACTCGCGCAAGCGCG
TTGTGGCCTTTAAGCACCGTGTGCTGGACCTGCTGGAGGTCTACATCAAGCGCGCTGCCGTGCTGCTGAGCCGGTCGCAG
CAGCAACTCGTCTTCCGTCTGCTGGTGCCGCTGGTCGAGCTGGTCCGCGACACCAAGGAGCCGGCGCTGTCGCAAAAGGC
CGTGCGGATTGTGCAGACAGCCCAGCAGCAGCTGAAGCGAGCGCGGGGCACTGTAGAAGGGGAGGGGGAGGAAGAAAAGG
GGGAAAAGAAAAAGGAACAAGATAAGAACCAAAGGGCAAAAGGCCGCTCGGATACCTTCAATGTCGAGCTCGCCATCGAT
ACCCTCGAGGCCATTCATCGCACCACCGATCGCGCCGACAGCCGGGCCTTTGCCACGGCCGTGTCCGCGGCCAGCCTGGC
CATCGCCTCGGCCGTCTTCGCGGCTGACCGCAATGCCTACCGCCGCGTGGCTGACGTATATCGCCAGACACAAGACCATT
GGGTGCTGGACGGATGGAACGTGCGTGCGTCGCTGTTTACCGATTGGTACAACTGGTGCCAGAGCGTGCGGACGCGGCAG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62