GenePrediction:GLEAN_4387 Details

Name: GLEAN_4387
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:206560..203757 (- strand)
Length: 2804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:206560..206350 (- strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_179:206270..205882 (- strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_179:205308..205024 (- strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_179:204848..203757 (- strand)
Length: 1092
>GLEAN_4387 class=GenePrediction position=GCSC_179:206560..203757 (- strand)
ATGCCGACCCGACACCCATCCAGTCGACCGTTCCTTGCTGCTGAAGATGAGGACGGGCGTCCCCGGTTTGCTGACGACCT
CCTGCAAGCAGCCAAAGAGAGGCCACAGACGACGCTGTCTGAACGAGTCGATCCGGCCGGGTACATGTCCTCGTCGACGT
GGAGCATCGGAAGCCGTCACGGTCCGGACACGGGCGAGTACGAGATGAGCGGTACGGTCTCTCCTTGGTTCGTCCGGCAC
CAGTCGGCAGCACGGAAACTGACATGCCTTGCTGCAGTTGTCAACGACAGCGGAGTCTACCTGCCAGTACGTGAACGACA
GGACGACCAACATGGCCTTGATCCTGACGGCTTTCCTGCAGCTTTCCCCCACCAGCGACGATGCCAGCCGGCCGCATGGC
CTTCGCTCGCGGGCGTCCACCGACACGCGGAGCGGCGGCCCGTCCGAGAACGAGCCGTTCTTCCTCTCCCGCGGATCTCT
CGACTCGTTTCGCCGCTCGTTTGACATCCGCGCCACGCTGCCCAACCTGTCCGCGCGTGTCCAAGGAACTGCTCCGGCAC
AGGCAGACGGGATCGAGTCCAGAAGCAACAGCAACAACAACAAAAGGGCTGCCTCTCGCTGTCATGACGGCTGGTCACAA
GCCCGGACAGAGTGGTCGCCATGGTGCCGAGACGGCCAGGTACGAGGAGCCGACTTTCATGGTCCCGTAACCATCGCCTT
CCGAGGCGTCGGAGGCGCGGTCTTGAGAAGATGATCTGTCTTTCTTTCGCTTTCCGTTATCTTCCTGCATATGTGGACCT
GACGCTTCGGTCGGGCCGGATCTGGAGTTGCTGGCTACGAGTAAAAGCATTGCTCATTTCTGGTTGCCCTCTTTTTGTTC
TTTGTTCTTTGTTCTTTTTTCTTCTTTCTTTTCTTTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTTTCTTTTTTT
TTTCTTCTTTTTTCTTTCTCGGCTTCATTGGTGCTATCTTACAGGCAGTAGGAATTCTACCTTTCGACTTGCCTCATCCT
GCGTGTGCACCGGTCTGCGGCAGAGTCAAGCCACTCGTTCGTCAACGTGTAGTGGGACTCGACCTAGCGCCAATGGTGTT
GAAATACTATTGCACCATAATATCTGGGGCAAATCGGGCTCTTTAGCTGAACTAAGTCGACGATATCGGCTCGATAAGAC
AACCATCAACTTTTCTTCTCCCATCCACTCTGTCGTCTTCTCCTCGATTTAGCCAGACACAACGCTTCGCCCAGACAGCC
ATCGTTCCGAACCGTTCTTCTTTGTGCCGCATTACGACAAGATGGCCGGCAATCCGACCGACGCAGGCGTCCCGCCCGAA
GGCCCCGGGCATCTTGCGGCGGTGTTTGAGCCGTATCAGCTGTCGCTGGCCTCGCGCGCGATGCATGCGGATGACTACAT
CAACTCGCACCGGGCGGTGGCGCCGCCGATGCATTTGTCGACGACGTTCCGGTATTCGAACGATCCAGACGTCCTGTCGC
ACTGGGACAACACGGATGTGAGTGATTACTTTCTCTTCTCTTCTCGTCTCGTCTCTCGTCTCTCGTCTCTTCTCTCGTCT
CTCGTCTCTCGTCTCTCGTCTCTCGTCTCTCGTCTCTCGTCTCTCCTCTCCTCTCTCGTCTCTCCTCTCCTCTCTCCTCT
CTCTCTCCTCTCCTCTTAAACTAACCCCATAGCCCAATGCCCCGTTCGACTCGCACATCTACTCGCGCGACTCGGCCCCC
AACGCGACCCGGCTGGAGGCGATCCTGAGCAACGTGCTGGGCGGCCCGGCGCTGACATATGGCTCCGGGCTGGCGGCCTT
CCACGCGATGATGGTGCTGCTGAACCCGCGACGGGTGGCCATCGGGGGTGGCTACCACGGCTGCCACGGCGTGCTGGCGC
TGCTGGGCAAGCTGACGGGGCTGCAGCAGCTCGAGCTGGAGGACGAGGCGGATCTGGCGAAGCTGCAGGCGGGCGACGTG
ATCCACGTGGAGACGCCTCTGAATCCGACGGGCGAGGCGCGCGACCTGGCGCGCTATGCGGCGCTGGCACGGGCTCGCGG
CTGCTATCTGACGGTGGATGCGACGTTTGCGCCGCCGCCGCTGCTGGAGCCGTTCCGCTGGGGGGCCGACGTCGTGATGC
ACTCGGGCACCAAGTACTTTGGCGGCCACTCGGATCTGTTGTGTGGCGTGCTGGCCGTCCACCCGCGCCACGTCGTCGAG
GGAGCACCGGTGCCAGCCACCGCTTCCGGGGCCAAGACCTGGATCCAGGCCCTGCGTGACGAGCGGCTCGTGCTCGGCTC
CGTCATGGGCAACCTCGAGAGCTGGCTGGGCGTGCGCAGCCTGCGCACGCTCGAGCTGCGCGTCCTTCGCCAGAGCGCCA
GCGCCGGCAGCCTCGTAGCCTGGCTGGCCGCTGAACAGGCCAAGCCCGCAGCCAGCGCCAGCGTCGTCTCACGGCTGGTC
GAGCGCGTGATCCATGCCAGCCTGCAGCCTGAGGCCGCACAGCCGGACTCGTGGCTGCGGCAGCAGATGCCCCGCGGCTT
CGGACCCGTCTTCTCCATCGTGCTGCGCGACGAGACCCTCGCCCGCCGCCTGCCCAGCAAGCTGCAGCTCTTTCACCATG
CCACCAGTCTCGGCGGCGTCGAGAGCCTGATCGAGTGGCGCGCCATGACCGACAGCACCGTCGACCGGCGGCTGCTGCGC
ATCAGCGTCGGCGTCGAGGCCTGGGAGGATCTGCGGACAGACCTGCAACGCGGCTTTGCCGAGCTGGAGGCCGAGAGCAA
GTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62