GenePrediction:GLEAN_4389 Details

Name: GLEAN_4389
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:192686..191804 (- strand)
Length: 883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:192686..192378 (- strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_179:192214..192069 (- strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_179:191987..191804 (- strand)
Length: 184
>GLEAN_4389 class=GenePrediction position=GCSC_179:192686..191804 (- strand)
ATGGCCCCTCTTTCCCCTGAACAGAGGGACAGGTGGCTGACCAGCGTCTCGCTACCTCGCCAGGGCATCGTTCCCCCTTC
AACCGGCTCGCCGACATTTTCTCACCGCAGCCAGAGCTGTGTTATTGTTTGGGCTGTCCTGGCTGCCCCGAGTGGTATCT
GGTGCACGCGGCCGCATATTCGGCGGCCCGCTAACGTCTGCTCGCCAAGTTGGTGCCCCGCCATCCTGAGGACAGCCCAG
GAGCAGTCGAGCGCTGCCACTGGCGCCCACAGCCATCGAGACGATCGCGAGGACGTTTGCCAAAGTGCGGTGTGTGCAAA
AAAGCACCACTACTGTCACCACGGCCACTACGGCCACCACAACCACCACGGCCACCACCCCCATGCAGCCAACCACTCGC
TGGCCTCAGCCAGGAAGTGAGCCACGCCTTTCCCTTCTCACCAGGCACGCGTCTCCTGACTGCGTCCTGCAGTTTCAGAA
CCGGTCGCCTCTGGGACACATCTTGACTTATTTACACCCCCACACTACGAGCACCGCATCGGCCGGAAACCCGACCTGCA
ATCGTTGTTGGGCCCGTTTGGTTCCCGGCATGGCATCCCGGCTGGGCGAGCCTAGCCCGTTTCGACTCGTTGGGCACAGC
TCTTCCGACGGGACCCGGGCATGATGTGCCTACGACGTATGCCTGACTGATTACATCAGCACCTTCGGGGTGCCGGACCA
TTACGCCTTCTCACCGCAGCAGCCTTTACCCCAGACGCTGTACGCAGCTGCTGCCTCACCGATGCGCTGCTTCGAGGCAG
GGCGGCCTCCGCCAGGGCGGCCAAGCTCGACAGGCGTGACGCAAACGCGCTCCCTGCAGTGCACGCCCGAAAGCTCATCA
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62