GenePrediction:GLEAN_4390 Details

Name: GLEAN_4390
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:186788..185781 (- strand)
Length: 1008
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:186788..186758 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_179:186664..186201 (- strand)
Length: 464
Type: CDS
Source: GLEAN
Position: GCSC_179:186105..185877 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_179:185806..185781 (- strand)
Length: 26
>GLEAN_4390 class=GenePrediction position=GCSC_179:186788..185781 (- strand)
ATGGCGTCTCGCTTGGCAAGAAACGCGGCAGGTGGGTTCTGGCGGTGAACGGAGGCGCTGTCGGTGCCATTGGCTGTCTG
CGGGCGTTTGCTGACCATTTCTCGTTTTTTTTCTTTTTTTATAGGGCTCGCCCGCCTGCGTCCGACTCTCCTCTCGCGAT
CGGCCGTGCCGGCCGTGACGGCGCTGACGAGCGTGCGGGCGTCGTCGACGACGCCGGCCGTGCCGACGGTCGACCCCAAG
GTCAAGGCCAAGAGCATCCTGGACGCGCTGCCGGGCAACTCGCTGATCAGCAAGTCGGCGATCCTGTCGTCGGCGGCCGG
GCTGTCGATCTACGCGCTCAGCAACGAGTACTACGTCGTCAACGAGGAGACGGTGGTGGCGTTCTGCCTGCTGTCGGTCT
GGACGGCGCTCATCAAGTTCGGCGGGCCGATGTACAAGGAGTGGGCCGAGTCGCAGCACGACAAGATTCTGGGCGTGCTC
AACGCGGCCCGGGCGGACCACTCGCAGGCCGTCAAGACCCGCATCGAGACGGTGCAGGAGATGTCGGGCGTGATTGGCAT
TACCAAGACGCTCTTTGAGGTGTCCAAGGTGCGTGGGAGCTGTCCCATCTTGTCGGATGCCGGCCTGTCGTTTTTTCTTC
TGCCGTCTCCACTCTCCCGCTTGTCTTCTCCCTTCCCTAACAGGTCCAGGAAACGGCCAAGCTTGAGGCCCAGGCCTTTG
AGCTCGAGCAGAAGACGGCCCTTGCTCACGAGGCCAAGACCGTGCTCGACTCGTGGGTTCGCTACGAAAGCCAGGTCAAG
CAGCGCCAGCAGCAGGAGCTCGCCCAGAGCGTCATTGCCAAGATCAAGAAGGAGCTCGAGAGCCCCAAGGCCCTGCAGCA
GATCCTGCAGCAGGCCGTTGCTGACGTCGAGAGTACGTACCGCTTGCGCTCGGCGCACGCACTTCCGTCCAATCCGGTGA
TCCGAAACTAACCCCGGCGCAGAGATCGTGGCCTCCCCCAAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62