GenePrediction:GLEAN_4391 Details

Name: GLEAN_4391
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:180057..178892 (- strand)
Length: 1166
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:180057..179996 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_179:179906..179242 (- strand)
Length: 665
Type: CDS
Source: GLEAN
Position: GCSC_179:179176..179027 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_179:178971..178892 (- strand)
Length: 80
>GLEAN_4391 class=GenePrediction position=GCSC_179:180057..178892 (- strand)
ATGCTTCTGCTCGACTACCAGAACGTTCTCATCCAGACGGTGCTGACAGAGAGATTCTCTGGGTAGGGCTCTCCCCCGAT
CCATCCGTCTCCTTCTCCTCCCTTCTCCCTACCGACAAGCTGCTGACGTCTCCTGCCGTCCATCCTCTCAGGGCACCGCC
TGCACACATTGACCAGACCGTGTCCGACTTTGACGGTGTGCTGTTCCACATCTCCACGCCCGAGTCCAAGTCGAAAATTC
AAATCTCCATTCTCCTGCGATGCTATGACGACCTGGTCAAGTATGGCGCCAAGGAGGTGCTGGAGCGCGAGTACGGCCCG
CACATTGTGGAGCCCGAGCCCGGCTTCCAGTTTTCCATCGTTGTCGACCTCGACCAGCTTCCGGCCGAGCCGGAGGCCCG
CACGGCCCTGGTCGACAAGATCGCCCTGCTCAAGCGCAACATGATGGCCGCCCCGTTCGAGGCCGCCTTCGCCGAGTACT
ACAAGCTCAAGGAAGAGGCGTCCAAGTACACGTCCGAAGAGGCGCCGCAGGGCATCCGCGAGGGTGGTGAGGTCATGGCC
GTCCACTACCGCGAGGAGGAGGCCATCTACGTCAAGGCGAGCCACGACCGCGTCACCGTTATCTTCAGCACCGTCTTCCG
CGAGGAGACCGACCGCGTCTACGGAAAGGTCTTTATCCAGGAGTTTGTCGATGCCCGGAGGCGCGCCATCCAGAACGCCC
CTCAGGTGCTCTTCCGCAACGACCCCCCCCTGGAGCTGCAGGGCGTGCCGGGCGTGAGCACCACCGACACCGGCGAGATC
GGCTATGTCACCTTTGGTACGTGGGCCGCCGTCTTGCTACCTGATGTCTTTCCCTTGCCCCCTGCCCTGCTGACAAGCCA
GTCCTCTTCCCGCGCCATCTCACGCCGCAGCGGATGCCCGATGTGATCTCGCACATCCAGACCTTCCGCGACTACTTCCA
CTACCACATCAAGGCATCCAAGGCGTACATCCACTCGCGCATGCGGAAGCGCACCGCGGACTTCCTGCAAGGTATGCTTG
ATACCGGAGAGAGATTCGCCTGCAGAACATAAACTGACCCAAACAGTTCTGCGGAGAGCCCGGCCAGACAACAACGAGGA
GAAGGAACGCAAGACAGCAAGCGGGCGTACATTCAAGGCTCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62