GenePrediction:GLEAN_4392 Details

Name: GLEAN_4392
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:178426..176960 (- strand)
Length: 1467
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:178426..177968 (- strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_179:177691..176960 (- strand)
Length: 732
>GLEAN_4392 class=GenePrediction position=GCSC_179:178426..176960 (- strand)
ATGCGATGGCCCTGGAACGGTGACGGGAGCAAGGAGGGTGCGACAGCGGCCGTGTCGTCGCCGACGTCCAGCTCGTCCGC
CTCTGCCGACTTGTCCTCCCCCTCCTCGTCCTCCTCCTTCACAGAACTGCCGCCGGTCAAGCAGCTCGTCTCCTGGACCG
AATCGCTGAAAGAGGCCAACTGGGAGCACTACAAGGACCCCCAGGCCTGGGTGACGCCGACTCTGGCCGTGGGCGCTGCC
TTGGGCTTTTCGGCCTTTTACCGCTCTTACCTGCGGCGCATCCCCAGCACAAACCACATCCAGCCGCGGTACTTTCGTCG
ACGCAGCCTGCTGGGCAAAGTGACCAGCGTCGGCGACGGTGACAACTTCCATCTATACCACACGCCGGGTGGCTGGCTGG
CCGGCTGGGGCTGGCTTCGAAAGGTCCCTTCCTACCGCAAGGACCTGAAGGGCAAGACGGTAAGTCGACTGCACTTGGCT
TCATTTGTACTTCTTGTCGGACTGGCTCCCATCTTGCGGGAAATGCATGTTTTCTCCTTTCTAGCCATCGGCTGGCTGCA
CCCGTCTCTTCCGATCGTGTCGGTCCCAGACGTTGTGCTATTTGCCTGATTTTCCCCCTGTGGGCCCAACTGTCCGATTG
CGTTCCTGGATCGGTGTAGCTCCTTCTGAGCTACATGCAACGTCCATATCGTCTACGACGGCCCATGCCCAGTCGCTAAT
GTCGATGAAACCCAGATCTCTGTGAGAATAGCAGGCGTCGACGCGCCAGAGTGCGCCCACTTTGGCCGCCCAGCACAGCC
CTACTCGGGTGAGGCCCTGGACTTTCTCACATCCTATCTGCTGGGCCGCCGCGTGCGCGTGTACCTGTTCCGCCAGGACC
AGTACGAGCGTGTGGTTGCTCGCGTTGTCGTGCGCCGCTTTCTCTTCTTCCGCAGCGACGTCGGCCTCGCCATGCTCAAG
CGCGGTCTCGCCACATGCTACGAGGCCAAGACGGGCGTCGAGTTTGGCGGCCGCGAGGCTCAGTACCGCGTGGCCGAGGT
GCGCGCCCGGACACGCAAGCGTGGCCTCTGGGCCGGTAGCGCCGGTAAGGGCGGCATCGAGACGCCACGCGAATACAAGA
CGCGGATGGCGGTACAGGATGCCGAGAAGGGACACACAACGACAACGGCCCCTACCACAGCAGCACCAAAGCCTGCTCTC
CCGGCTCCTGCTGCCACTCCTCCCGCTGCCGTTGCTTCGTCTGCTAAGCCGTCTGCACCAGCCACGGTGAAACCGTCTAC
GACAGGTGGAACGAGTAGCACAAGCACATTCTCGGCCGGAACGGCAGCCAAGATCACGTCGCCCGCTGCCAAACCGCACA
CTACAGCACCACACGCGTCCTCGTCTTCGTCCTCGACCTCGCCGTCGGCACCGCCGGCATCCGCAGCTGCATCATGGGCC
AAGGGCGTCCCTGGGCAGAAGCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62