GenePrediction:GLEAN_4393 Details

Name: GLEAN_4393
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:173476..168166 (- strand)
Length: 5311
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:173476..169727 (- strand)
Length: 3750
Type: CDS
Source: GLEAN
Position: GCSC_179:169026..168869 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_179:168822..168700 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_179:168617..168509 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_179:168447..168275 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_179:168208..168166 (- strand)
Length: 43
>GLEAN_4393 class=GenePrediction position=GCSC_179:173476..168166 (- strand)
ATGCGAATACCGCTACGGCGGCGCAAGGATGCCGTCGCCTCGGCTTCCTCGATGCGACAGCCGGTCTTCTCCTTCGCCAG
CGCAGCGACGTCCTTCCTCGCGCTGGCTTCGATGGCTCCGGCACCTGCACAGGCACTAAATTTTACCGCTGCACAGTCAC
CAAATGTCGACCTCAGCAGCCTTGGTAGGATAGGGATTGGCGGCGATTTCGCAGGCATCTCGATGTTTCAGTTCGAGGAG
CAAACACAGAGCACCGTCTCCACAAATGGAAGCGAGGGACTCATGGCCCGGCTCCCGAACGGTGCGCTGACTACGATTCT
CCATACCGATGCCTCGATCATGGCGATGTGCTCCTTCGTTCTTAAAGACGGCACCAATGCCGGCGTAGTCCTCGGCGGAA
ACTTCACCAGCATTGGCAGCCAGGAGGCCACGGCTATGGTTCTGTTCAACCCCAACACCACAGAAGTCACTGCTATTCCT
GGGCTCTCCGGCCAGGTCAACGCTGTCTTGTGTGACGAAGAGCTCAACACCGTCTTTGTCGGCGGTAACTTTGTCGAAAA
TAGCTCGACAAATGCCATTACCTATGTTCACGGCTCTGGATGGACTGCCCTACCGTTTGCTGGATTCAACGGGCCGGTGA
CGTCCATCGCCAAGGCATTCAATGGGCATATTATCTTTGGTGGCAGTTTTACCGGTCTGGGAAACGTCAGCACGCCGAGC
GAAGCAGACGAACAGATTATTAACATCTCCACGGCCAACCTGACTGCCAGCGGCTCGACGGACACGACCGGATTCTCCGA
CCCCGCCAACATTGTTTGCAAAACAAACGGGACTGACGGCGCTGGGAATACCTGGCTGCTCGCAGACGACACAGCTGGCT
TCTGGGAGGCAGACTTTGGCTTCGGCTTCCATCCGACCAAACTTCGGCTCTGGAACACGCACCAAGACGGACGTGGAACG
GAAACCTGGCGTTTTACGGCATTGCCCTTAAACGGCATCATGAACTTTACTTACATCGATCCCGACACCGGCGCGAATTA
CACATGCACGAGCGAGTGTCCTCTCAGCCACAGCAAGAATGTCACATACCAGGACTTTTATTTCGTCAACTATGTCGGCA
TGGATTCCTTTCGCATCGACATCTCGGCCTGGTACGGCAGCGGCGGCGGCCTAGACGGAATAGAGCTCTTTGAAAACGAG
ATATTCTCGTACGCCATCGACGACTTCAACGAGCCCAACTGCACGGCGTCGTCTGCAGTAGACGTGTCTTCGGCTACGTC
GACGGGTCCTTGGACAGAGTCGCCGTCTTTCCAGAGCAGCTCCAGGTATCTGACGGCCAGCTTGTCCTCGCCCATCGATT
CCTCTTCTGCTTCTGTCGTCTTCTCTCCGAACATTCGGCAGTCTGGCAACTATACGGTTAACATGTACACTCCTGGCTGC
CTCCAAGACGGCAGCTGCGGCACCCGTGGCCAGGTAAACGTTACGGTAACCATGTCCAAAGGCGTCACATCGAGCGTCCG
ACTGTATCAGACGAACAACTATGACAAGTTCGATCCTGTATACTACGGCGCCGTCGACGCGGCCACTGAGTCCTTCCGGC
CAACTGTGACCCTGACTCCTCTGGACGGTCAGTCGCTGAGCGAGATGACGATTGTGGCGCAACGTGTCGGGTTTACTCTG
AACAACTCGACCGGCGGCTTAAATGGGCTCTTCGAATACGATCCGTCACAGAGCTCGTTCGACACGAGCACCTTTTCTTC
GTCGGCATTCGACACGCTGGGCTCGGCCTTCTCCTCGGGCTCTGCCGTCATGGCCCTTGCGACCAGCGGCGAGGTGACGT
ACGTTGCGGGCAACTTCACGTCGACAAACGCCAGCAATATTGTCTCGGTGAGCAGCAACGGCTCGTCTGTCGAGTCGCTT
GACGATGGGCTGAACGGCGGCGTGTTGTCGATGGTGCTGAACGGCACGAAGCTCTTCACTGGTGGCATATTCAACTCGTC
CAAAAGCGGATCTGCGACGGATCTGAACAATGTCGCCGTCTTCGACACGACGACCAATGTCTGGAGTGCACTCGGTGCTG
GCGTGAACGGGCCCGTCATGAAGGTTGTCCCGATGACGATGAACATCACAGGGAGCTCTGCCGACGTCGTCTTTGCCTTT
ACCGGTGGCTTCGACACGCTTCTTGCTTTCGGATCCAACTCGGCGGTGACTGTTGACGGGTTTGGTGTCTGGGTGCCGTC
ACAGGGCAATTGGCTTCAGAATCTGGACCAGACTGTGGAATCTATTAATGGCGTATTGCTGTCTTCGCTACTGAACGTGC
CCGGGGCCGATGCTCTCTATGGCGGCTCTCTCTCTTACGCGCAGGTGGGCTCTACAGATGTTGCGACGCTGACAAACTCC
GGAATTGGGTCGTTTGGAGCGCACGTCCTGCCGTCGTCGGCCTCCTCTTCCAGTGCAGTATTGAAGCGGGACACTCTCTC
GAGCAGCTCGGTAGCCGGTGTCCTCACGGGCGTCTTCGACACGTCTGGCAGCCGCAACAAGACGATTCTGGGCGGACATT
TCTCAGCCAAGTCGACCAACGGCACGACAATCGAAAACCTGCTGATCATTGACCACAACAAGAATGGGTCGGTATCGGGC
TTAGGGTCGGGCATTTCAAACTCGTCGACCTTTGCTGCACTGGCTGTCACGGGCAGCACACTCTTCGCTGGGGGCAATGT
GACCGGCACGGTCAACTCGGCGAGCGTGACTGGTTTGGTGTCGTACAATCTAGCGACGGACAGTTTCACCATGCAGCCTC
CGTCGCTTTCGGGTGGCAACGGCACTGTGATGGCCATCAAAGTTCGGCCAGGCACGACGGACGTCTATGTCGGTGGCTCG
TTTGCACTGGCCGGCTCTCTCGGCTGTCCAGCAGTGTGCTACTACAGCACGAGCAGCAACCAGTGGAACCGGCCGGGCTC
GAATTTGGTCTCGGGCACGGTGAATAGCATGGTGTGGACGTCGAACTCTGAGCTGGCGGCCGGCGGCCGGTTTTCTGTGG
ACAGCATCGGGACCGTTTTCCTCGGCCAGTACGACGCGTCGAAGAGCGTGTGGAGCAGCTTTCCCGGCTCGTCGGTCATT
CCCGGGCCGGTTGATGTTCTCGTGCTCGGGTCGAGCGACGGGAGCGAGCTCTGGGTGGCGGGCACGGCCAGCTCGAACAG
CTCTGTGTATCTGCTCAAGTACGATGGCAAGGACTGGGTGGACGCGTTGGGGGCCAGCGGTCAGACGCTCTCTTCTGGCA
CGAACATTCGCAGCCTGCAGGTGTTTTCGGCGTCGCCGAAGCACGACTCGACCAGTGTCCTCAGTTCTGATCAGGTTCTA
GTGCTGGCCGGCTCGATTGTGCTTCCAGGCTACGGCACCGTCTCAGCAGCCATTTTCGACGGCAAGACGTTTAAGCCGTA
CATGTTGACGATGTCGTCGGGCAACAGGGCAAGCAGCATTGCGAGCATCTTTGTGGAAAACAACAACTTCTTCACGGCCA
AGTCTCGCAAGCATCTTCCGCTTGTCGGAGTCGTGCTCATCGGCCTGGCCATTTCGCTGGGCCTGATGCTGATCATTGTG
GCGGCTGGCCTCTTGCTTGACCGGTTGCGCAAGAAGCAGCAGGGCTACATCCCGGCTCCGTCGATGGCTGACACGGGAGC
CAACCGAGCGTGGATTCCGCCAAAGGATCTCCTGGATTCGTTGGGGCGACCGCCACACGAAGCGCCACAGGTGTGAGCGG
ACGAGAAAGCATTGGATGGGCGTTCAATTTGCATTCGACATTGGCGTTTTGCTTTGTTTTATTTTATTCTTATTCTAAGT
TCTTTGCTTTCCTCTCTGCGACAGGCAGAATCGCGGTCCCGAGCCTGAAGTTGGGCAGGGGATATTCGGCGGAATATGGG
AGGCCCACTAATTATGGAAGATACCCAGACCGAGTGGAAGACAGCGGAGGAACAGTTTGATTGAGCAAGGTCGTTTCGGC
TTGGCTCGTCAGCACCATCAACAAACCATCTACACAACAATCACCTCACAATCTACCCCTTTCCCCTTTCCCCTTCTACT
CATATCTCATGATCTTATGATACCTTGTAATGTTTATCTTTTTATTATCAACTACCATATTTGTGGCATGTACAATCCAT
CAACAGCGGGCAGAGACCCCAGCAGCAGTTTTCTTTGAGTTAGCAGAAAGTAGCAGATGAATCGTCGACTGGTGCACTGT
GTCGTAGAGGCTAGGAGGTTAATGCCACGCTCATCTGTAACCGCCGCACTCACGGCTAAGCTCATGGTATCTAGAAGAGC
ACTACATTGGATCCGATTGACAAGAAGACACGCCAAGCGCGCCATCCAGCCACGAAGATATCATCGGCTATTTCCGTCTC
CTGGACCTCGAGAGACAGTAGCGTAAGCGGCCAGAGAATTGGTATAGCAGCCATGGGGCCATGAGAAAGGCCCGTTGCCG
TCTTCTCATCTGACCCGACTGGACAACGTCGTGGCCACGCAGGGGAAGCAGAAGCGTTTAGGCCTTGTCGGTCTGTGGAA
GGAGGTCTTCGACTGGTATCCGGCCGAGTACCCGGCAGCGGAGAGAAGGTCAGCTGACAGGTCCAGTCTATATGAACTAG
TTCGACCAGTCCAGATGCATGATCATCTCCCGCTACCCGTCCTCCTATATGAGCCTCTGGCTCAAGGCCGAAAAGTACAG
CGTGCCGCAGATCAACAAGCTGCCGACCGGAATCAGCGGCATCTTCATCGTCTCCTCGTAGCTAGCAACGATTGTCGCGG
CCATCTACCCGTCATGGATCATCTACACCATCGTCACGACCTGCTGCCTGCTCTCGCAGGTTTGTGGCCTGGTACTTTTT
CGGGGTGGCCGGCTTTGCGAGTCTGATCCTCTACTCGGCCGTCAACACGATTGTGAAGAACGACTCGGAAGAGAGAGCAC
TGATCATGGTATGAACAAGAGCCTTGTCCTTATTCTTTTGTCTCCCTTCTTGTTTCCTAACTGTCCAAGGGCTCCATGAT
GACATTCGGGTACTCGTTCAACATCTGGGTGCCTCTTTTGCTCTTCCCGACAGCCGGAGAATACGGCGCTCCTCGATGGA
AGAAGGGCTGGCCTGTCACGATTGCCTTGTGCTTCTTCTTCTGCCTTGGCTTTACCACCGCCACTGTGCTCTTCCGGAGA
AGGTGTGTAGATCTTTGGCACGGCTGTCGAAATACATACATGCTAACACGTGATTCGTCAGACAAAAGAGAACGGCTCGT
GGTTGGTGCTACTGTCGAGCTTAAAGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62