GenePrediction:GLEAN_4394 Details

Name: GLEAN_4394
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:156632..153579 (- strand)
Length: 3054
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:156632..156453 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_179:156392..153579 (- strand)
Length: 2814
>GLEAN_4394 class=GenePrediction position=GCSC_179:156632..153579 (- strand)
ATGGCCTCCAACTACCACATCGAGAAGCCGTACGTGCTGGCGACGCTGCCGCGATCGCTCGCAAGACCCGACAGCAGAAG
CCTCGTCGGCGATGTGTACGGCCAGAAGGCTGGCGCAAAGAAGCGGCGGCGCCCCGAGGTGACCGTGGGCATTGACGGCG
AGGCTGCCAATCTGTACGATGTAAGTGTTATTTTGCTGCTACAGCTTTCACACTTCTACTTCACTTTTACTGACTTCCAG
ATCGCCTCCTCCCGGCTTATCACCTCATACCCGGTCCCCCCCCAGGCGACGTTCTCATGCCCGCCCTGCTCGCTGCGGTT
ACGCTCGGCCGCCAGTAAGAAGGCCGACGTGGCCCGCTTCACCTACATCTCGACTCGGGAGCCGGCCCGGAAACTGTCGC
TCTTCAGGGACACCGTTGGGGCCTCTGGCGCCACGGCCTCGGCCACAGTGTCGACCAGCCTCGGCCGCTCAGGCAGCCCC
GTGGTGTATCTGACGACGAGCAGCAGCAGCAGCAGCAGCAATGACGGTCAGCTTATCCCACCAGATTTGCTGGCCGTCAG
CCAGGATGGCGAGGTCACTTTTTTCAACGGCGAGACGCTCGAGGAGAAGCACAAGGTATCGGTGGCAACATTGTCGCAGG
ACTTGCTGCCACGCGGGTCCGTCCTCCGGGTCGAACTAGCCCAGACGGCCCAGACAGCCGACGTGCTCAAGGGACTCCAG
TTGGGCGAGGACTACCTCTCGGGTGTGTTGGCACAGAAAGTCGACGTGGCCGCTGGCGGCTTCAACCCGGACGTTCTGCT
GCTCATCACGGCGACGGCAGACACGGCAGCACGATACCTGCATGTGCTTGTCGTCGACCCTGGCCACTCGGCTGCCGTCC
GCTTGGTCCAGGTGCACCACATCCGACTGCCCTCGTCAGCCACCGAAACGACATCATCCCCGACAGAGCATCAGCAACCG
CTGTTCCGGTTGGACGTCGCGTCTGGATCGCTGTTTGCCCTCGACGGCGAGACCGTGGTGTCGTACGACCTCGCGCGCAG
CGTGCCGCGCATCATCGGCCATATGTCCATCCCGGGTGGCACGTCGTTTCTGCAGCTGTCCAAGTCGAGCATCCTCGCGT
CCACGGCCACGACCTTTTCCGTCTACAACCCTGTCTTCAGCTCGCTGCAGGCATCCACGCCCCTGGACCTGGCCAAGGAC
GATGCCCAGCTGCCTCCCCGTCGATCGTGCGCCTTCGTCTCGTACTTCTCGCAGCTCGAGCTCGCCGTGGCTCTCGTGGA
CGCACACTATCTGGTTGCTGTGCAGCTGGAGCCGCCGCGGACTCGCAGCAAGAAGCGTCGGGCCGATGGACTTCTGATTG
ATTCTATCGGACGCGGCGTATCCTGGAAGGAGGGCCAGGGCCAACCAGCCGGATCAGAAGGCGACGACGCAGCCGAGACG
CTGTCCGGCCGAAAGTACGTGCCGGGGACCGTGTCGACCGCCTATCTGCAGCAGTATAACGCCGACGTGTTGGTTGCCGA
CCGGCTGCTGGCAGACGGCGACGTGGCCGCCTTTGACGATTTCCTAGCTGAGAAGCTGAGTATCCAGAACGTGGCGGACT
GGCGGTGGCAACGGCCGCTGGATGCGGCTGATGGCGCCGAGGCTGTGAACGAGGCCCAGACATCGACAAACGATGCCGTC
GTTGTTGCTGCTGCCACGACCACCACCAACCCCACAACGAGAGCCACATACCCCGAAGCCGATCGTCGCTGGGTCGTGTA
CGCCATCGGACGCGTGCTGACCGTGGACCAGGCCGGATCAGCCGGACGGCTGCGGCTGCGCTGCGCGCTACCCGAGAGCG
ACATTGTCAACTACCTCGTCGATGCCGGCCATCTCTCGGTGGCAAACGTGTGGTCGGCGCTGCGGTCGGCGCTGCAGGGC
GTCGACGATGCCGACGCTTTCCTGGGCGAGGCGCTGCCAGTCACGCTGGCACACGTCGACCCGAGCCTGGACCTGCTGCT
GCGATGGCTGTACGCCACAAAGCTGGCGGCCACGGAGCTTCTCAGCGCGATCCTGCTGCTGATGCGCAGTCTGGAACTGG
TGGCCGCAGCCGAGGCGCAGCCCGAGGCCAAGCCACTGCTGACCAACGGTGCGGACGACCGAATGGAGGACGGCGACGAC
GACCAGAGCAACGATGTGGATAACGAAAACGACAATGACGACGACGGCGAGCTGCCTAACCAGGAGCTCGACAGGCTGGA
CCAACAGCTGCGCGTGGCCGAATACTTCCTGGAGCACGTGGAGAACGATCCGCGCGACCTGGCGCTAGACATTGCTATTG
GCAAGCTGGGCAGCTGTCCGGCCGTGGCGACGGTGTTGGGGCTGCGGCGCATTTTTCGCACGGACGAGATCCGGTCGCTG
ATCGAGGTGTTGCGCAAGCAGCTGGTCGACCAGGGCTGGGCGACGCGGTACGTCGACATGGAGGGTAGCGACAGCAAAGA
CGGGGCCACGCCGCTCAACTATAGCATCCGCCTAATTGCCGATCTGCTGGGCCGGTGCATCGATTCGGTGCGGCCGGGCG
AGTGGCTGGTCGACGATGCGGCGACTGCAACAGCCGCAGCCGCAGCAACAGCAGCAGCAGTAGCAGACAGAGAGGCCGAA
CACATTGCTGTCGGAGGTGTCAGCCCGGCTGCCGGCGACTTTTTTGCCTCGCTCAAGTGGCAGGTCAGCGCTGCACTCGA
GGGCGTACAGGAGGCGCTGTACTTGCGCGGGATCTTGGGTGAGGCTGTGCGGTATGCAACAGGCGTGCAGAGTGCAGCAG
CAGCATCGTCAGCAGTGACTGTCTCGTCCGGCGAGACTGATGTGCGGCCGACACGGGTGGACAAGGCGACCCTGCAGGCG
GCCGCGATGCTGCCGTTGGGGCTCAAGGCACCGATGGGTCTGGGGCGGTACGGCGACGTGACACCGACCAAGGTCGTGTC
GGGCGGCGAGGTGGTGAAGCGAAGCCGGCGTGAGATTGGCCACCTGACGAGCCAAAAGGTGGGTGCTTACACGCTGGAGC
GGATTGTGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62