GenePrediction:GLEAN_43 Details

Name: GLEAN_43
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:321359..324206 (+ strand)
Length: 2848
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:321359..321472 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_179:321590..322232 (+ strand)
Length: 643
Type: CDS
Source: GLEAN
Position: GCSC_179:322370..322438 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_179:322608..323974 (+ strand)
Length: 1367
Type: CDS
Source: GLEAN
Position: GCSC_179:324033..324206 (+ strand)
Length: 174
>GLEAN_43 class=GenePrediction position=GCSC_179:321359..324206 (+ strand)
ATGCTGGCTTCACGCCAAGTTCTGGCCGGTGCCATCCGGAGCCGGACAGCAATGTCCGGCCTGGGCATGCGCCGCACCAT
GGCCTCCGTCTCCAACGGCCCGCTGGACCGCAAGGTGAGTTTGGCAACTTGAGCGACCGGCCAATGCGCAACGGCTTGCG
TCTGGCTATTCGTCGTGAGGTCGATTAGCACACCTGCTAACGGCCGGCCCATTGGCCACGTGAACGTACAGGTCAGGCAA
AACATCTGGGAGGAGAACAACTTCATCAACTACAAGAAGATGTCCGAGAACCTCGACATTGTGCGCGCGCGGTTGAACCG
CCCCCTCGCGTACGCCGAGAAGATCCTGTACTCTCACTTGGACGACCCGCACGGCCAGGACATTGAGCGCGGTGTCTCGT
ACCTGAAGCTGCGCCCCGACCGTGTTGCCTGCCAGGACGCCACTGCTCAGATGGCTATCCTGCAGTTCATGTCCGCCGGC
ATGCCATCTGTTGCCAACCCGACCACCGTCCACTGTGATCATCTTATCGAGGCTCAGATCGGCGGCGAGAAGGATCTGGC
CCGCGCCATCAGCATCAACAAGGAGGTCTACGACTTCCTGTCCAGTGCCTGCGCCAAGTACAACATTGGCTTCTGGCGTC
CCGGCTCTGGTATCATTCACCAGATCATCCTCGAGAACTACGCCTTCCCCGGTGGTCTGCTTATCGGCACTGACTCGCAC
ACCCCCAACGCTGGTGGTCTCGGTATGGCCACCATCGGTGTCGGTGGTGCTGATGCCGTCGACGTCATGGCCAACCTGCC
GTGGGAGCTTAAGGCCCCCAAGGTCATTGGTGTGAAGCTGACTGGCCAGCTGTCTGGCTGGACTGCGCCCAAAGGTGAGG
TCCTTCCTGACCCATATGAGATTGTGGATCCCTCGATTGCTTAACCCCAATTATTGTGGGGCATCGGCCCTTGTCCAATA
TCATATGCTTCGAACCGACGAGCATCGCAAAACTGACGTTGTTCTACGCAGACATTATCCTGAAGCTTGCAGGCATCCTC
ACTGTGAAGGGAGGTACCGGCGCAATCGTTGAATACTTCGGTAAGTTTGACTTTCTATCCTCGAAATCACTCTGGTTTTC
TTTTGATTTTCTTGATTTTTGCCTCGCTGTGTTATGCGGAAACGTTCGCTTTGCTGCATATCGGATCTTGACAGCTCCTA
CTTTGGGAGAGCGCTTGAGACTGGTCTAACACGCGTGATCATTATGTAGGAGACGGTGTTGACAGCATTTCTGCTACTGG
TATGGCGACGATCTGCAACATGGGTGCTGAGATTGGTGCCACGACCTCCCTGTTCCCGTTCAACGACCGCATGTACGACT
ACCTTTCCGCTACCAAGCGTAAGGACATTGGTGACTTCGCCCGTGTGTACGCCAAGGAACTGCGCAAGGACGAGGGTGCC
GAGTATGACCAGTTCATCGAGATCAACCTGTCTGAGCTGGAGCCGCACATCAACGGTCCCTTCACGCCCGATTTGGCCAC
GCCGATCTCGAAGCTGGCTGAGACGGCCAAGGCGAACAACTGGCCTGAGGAGGTCAAGGTCGGTCTTATCGGCTCATGCA
CCAACTCGTCGTACGAGGATATGACCCGTGCTGCTGCCATCGCTCGCGATGCTCTGGACCACGGCGTGAAGCCGAAGGCT
CTGTTCACGGTCACGCCCGGCTCTGAGCAGATCCGCGCCACCATTGCCCGTGACGGACAGCTGCAGACGTTTGAGGAGTT
TGGCGGCCTTGTGCTCGCCAACGCGTGCGGTCCCTGCATCGGTCAGTGGGATCGCCAGGACGTGAAGAAGGGTGAAGCCA
ACACGATCGTGTCGTCGTACAACCGGAACTTCACCGGTCGCAACGACGGCAACCCTGCCACTCACGCATTCGTGACGTCA
CCCGACCTGGTTGTGGCGCTGACGATTGCCGGCACGCTCAACTTCAACCCCCTGACGGACAAGCTCAAGGACAAGGACGG
CAAGGAGTTCCTGCTGAAGCCGCCACCGCAGACGGACGGTCTTCCGGAGAAGGGCTACGACCCGGGCTTGGACACGTACC
AGGCACCGCCTTCGGACCGCTCGCAGGTGTCGGTCAACGTGGCCCCCACGTCGGACCGTCTGCAGCTCCTGACTCCCTTC
AGCGCATGGGACGGCAAGGACGCGCTCGACTGCCCAATCCTGATCAAGACCAAGGGCAAGACGACGACGGACCACATCTC
CATGGCCGGCCCGTGGTTGAAGTACCGTGGCCATCTGGACAACATCTCCAACAACATGCTGATCGGCGCCATCAGCGAGG
CCAACGACTCTGCCAACTCGGTCAAGAACGTGTTCACCGGCGAGTTTGACGCCGTCCCGGCCACGGCCCGTGACTACAAG
GCTCGGGGCATCCAGTGGGTTGTTATTGGTGACTGGAACTACGGCGAGGGCTCGTCGCGTGAGCACGCCGCCCTGGAGCC
GCGTCACCTTGGCGGTCTGGCCATTGTGACCCGCAGCTTCGCCCGTATCCACGAGACGAACTTGAAGAAGCAGGGCATGC
TGCCGCTGACCTTTATCGACCCGGAGGACTACAACAAGGTCAAGTCTGAGGACAAGGTACGTCGATTTTTGATGCACATG
TATGTGGAGAATGGCTGCTAACGATAATGTCCAGGTTGACATTCTGGCGACTGAGCTGGCCGTCGGCAAGCCCATCACTA
TGCGGGTGCACCGCCCCAACGGCGAGGTGGAGGACATCAAGCTGGCACACACGTTCAACGCCGGCCAGATTGAGTGGTTC
AAGAACGGCAGCGCTCTGAACACGATGGCCAAGGCCCACAAGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62