GenePrediction:GLEAN_4414 Details

Name: GLEAN_4414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1098800..1097061 (- strand)
Length: 1740
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1098800..1098637 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_161:1098553..1098467 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_161:1098389..1098119 (- strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_161:1097909..1097061 (- strand)
Length: 849
>GLEAN_4414 class=GenePrediction position=GCSC_161:1098800..1097061 (- strand)
ATGGCTCCAGATTATCCCCTTCCGGATGAGCCAACGAGTCTTATTGTAGACTTTAGCAGCCCGGCCGATGATTACAATCC
GATAAATTGGCCGACTTTTAAGAAGAGCTATACCAGCCTTCTTTACAGCCTTACTAGCCTAGGCTCTGTCTGGGCAAGCA
CAGCGTAAGCTGTGTGCACGGGACTGCGACAGACAGACAAATAGAGTAGACAGAAGTGCCTCTAACAGTTGTGCGTGGAT
GTGATAGATACGCGCCCTCAAACGCTAAGATAGCCGACGAGTTCGGCGTGTCCTCCGAGGTTGCTCTCTTAGGCACCAGC
CTCTTGCTTCTTGGGTCCGTTAAGACTTCTTGCCCTCCCTAGTCAAGTTAGCGCGGCTACGCTAACTTTAGTTTTCTGCT
TTGTTCTCTAGATGGGGATTTGGGCCGTTATTCTGGGCACCTCTTTCTGAGGTATATGGACGGAAATGGCCGGTGCTACT
TCCGTTTGCCGTCTCTACAATCATGTCCATCGGTACAGCCACGGCAAAAGACATCCAGACGGTCCTTATCACCCGTTTTT
TTACTGGTTTCTTCGGGTCTGCCCCAATTACTTGCACTGGTGGCGTCTTTGTGGATTTGTGGAAGCCATCGCAGAGGGGC
AATGCCATAGTTGGTTACACCCTTTGCGTCTGCGGTGGTCCGGTACGTCCCCTATCTTAGCTACCAAGATCGTTAAGTTT
AAATATTTTAAAGATAATGTACAAGAATACGCAACTAATAAAGACAGTCTTTAGGTCCGGTGGTTGGCGGCGCTATAATC
TACCGTGATATAAGCTGGAGGTGGACTGAATATGTAAATCTCTGCCAAGAGGTTATAAGCGTATAAGAACCTAAGGCTGA
CACGTACTTAGATTACCGCTTTTATCCAGGCCGTCGTCCTCGTCCTAGACGTTATTTTTATCGACGAGTCGTACGCACCC
GTCCTGCTAATCGACAAGGCCCGCATGCTCCGTAAGACGACGGGCGAGTGGGCGCTGCATGCCAAGTGGGAGGAGAAGGA
GGTGCGAGTGGTCGACCTGGCCGTTAAGTTTGGGCTGCGGCCGTTGCAGATGCTGGCCACGCCTATCTGCCTAGCCGTAA
CGGTATACTCGTCGTTCATCTATGCCGTTTTTTACGCCAGCCTCGCGTCGTTCCCTATTATTTTCCAGCAGACGCGCGGC
TGGGACGACCTGGTTGGGTCGCTGCCCTTTTTGGCCGTGCTAACAGGAATCCTAGCCGGCGCTGTTGTGAGCTGGCATAA
CCAGCGCCACTACAACTGGGCTCTAGCGGCGAATAGCTATATGCCCGTGCCTGAGGCGAGGCTTCCGCCTATGAAGATCG
CCTCGGTCGTGCTCGCTGGTGGACTCTTCATTATAGGCTGGACTTCTGCGCCCGAGCTGCCTTGGATCGCTACCGTTATC
GGCGTTGCTATGATGGGTTTTGGCTACTATACTATCTTTACCAGCGCGATTAACTACCTTGTTGACACCTTTCACCGTTG
GGGGGCTAGTGCCTTAGCCGCTAATACCTTCTCCCGAAGCGTGCTCGCCGCCATCTTACCGCTGCTTGTGCGGCCTTGGT
ATAACCGCTTAGGAAACGGCTGGGCCTTTACCGTCCTTGGCGTCTTTGCTATTCTTAACATCCCGATACCATTTCTCTTC
TCTGCTTACGGGCGCCAGATACGGGCAAGGGGAAAATATACAGCTAATATACAGGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62