GenePrediction:GLEAN_4415 Details

Name: GLEAN_4415
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1020393..1019472 (- strand)
Length: 922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1020393..1020268 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_161:1020212..1019472 (- strand)
Length: 741
>GLEAN_4415 class=GenePrediction position=GCSC_161:1020393..1019472 (- strand)
ATGGCTGTCATCACATTCCGGTCCAATGATGCTCTAAGAATCAATCCGCCAAGCGGTGATCAGCATCTCACAGTTAACGG
TTCAGACTGGCTCTGGACTGTGTTTGCCATATATGCCTGTTCATTTGTAAGTCAAGCCTAAGGAGAAGTGAATACAAGCG
AAACGAACTAATATAAATTAGATCGTTGTGGTTCTCCACTCATTTTTCGCCCGAGCTGGCGAGAAGGTTTTCCACTACAT
TTACGGCATTGCTCTTCTTGTCGGCTCCATCGCATACTTTACTATGGCCTCTGACTTTGGCTGGATAGCTATCTCCAACC
TTGAGAACAAGGACTTTGCCGCTACCCGACAGATGTTCTATGCAAAGTTTATCAACTGGGTTGTGCTTTTCCCCTCTGTC
GCTCTCAGCCTGGGCCTAATGTCTGGAGTGTCGTGGGCCACCATCATATACCACATCTTCCTTGCCTGGACCTGGATCAT
CGCTTACCTCGCCACTTCTGTTGTCGCTACTACATACAAGTGGGGCTACTACACTGTCGGCACCGTTGTCTGGATATTGC
TGGCCTTTGGCACCTTATATGAGGGTCTCCGTGCTGCTCGCCGTGTAGGCATTGTTCGCGACTACTGCATCCTCGCTGGC
TGGACTAACCTCTTGTGGCTGTTGTACCCTATCGCTTTTGGCGTGAGCGACGCTGGCAACAAGATCGGAGTGACTGCCAG
CTTCATATTTTACGGCATTCTTGACGTGCTTTTGATCCCTGGATTGACCTTCCTCACGTTGACACTGGCTCGAAACTGGG
ATTACAACAAGCTGAATATCGTCTTTACTCAGTATGGCCGTGTACCTATTGCCAACGGTGAATTCGCCGAAAAGGCACAG
GTCCCGGCTCCTGCACCTTTGACTGATAGTGCGGCTGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62