GenePrediction:GLEAN_4416 Details

Name: GLEAN_4416
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1012065..1007609 (- strand)
Length: 4457
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1012065..1011525 (- strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_161:1008902..1007747 (- strand)
Length: 1156
Type: CDS
Source: GLEAN
Position: GCSC_161:1007642..1007609 (- strand)
Length: 34
>GLEAN_4416 class=GenePrediction position=GCSC_161:1012065..1007609 (- strand)
ATGGGGACAGCTGATCTGGGAGCCTCTCATATGGGCGGCCTAATAGGCGCGAGCATACCATTTTCCGTCGCCTGTGGCTC
CAGCATGATTGCCACTATATGCATTCAGCCGATAGACACCGTCAAGGTGCGCATGCAATTGTTGGATAAAGGTCGGGGAA
CGGGTGCTGTATCGGTCTCCACTGTTGTTAAAGACCTAGTCGCACGCGGCGGCGTTATCAACTTGTACCAGGGTCTTTCG
GCGGGCCTCCTCCGGCAGCTGGTTTACGGCACACTTAGGCTGGGTTTGTTCTCGACGTTCGAGCAGCAATTGTCACGGCG
GGCCCGTGAGCAAGGTACGACGCTCGGATTTAGAGGTAGAGCGCTCGCCGGTCTTGGGGCCGGTGCCATCGCTGCATTTG
TCGGAAACCCGACCGAAGTTGCCCTCATTCGCATGCAAGCAGACGGCATGAAGCCCGTGGAACAACAGAGAAACTACTCT
TCTGCATTCAATGCAATCTGGAGGATTGCAAGGGAGGAGGGGGTGCTTGGTCTCTGGAAAGGTGCAGCGCCTACAATTTT
TCGCGCCATGTCTACCAATTTCGGGCAATTGGCATTTTTTTCCGAGTCCAAACATCAGATCCAACAGCACACGGATATGT
CGCATCCAGCACGCATAGCTTGTGCAGCAGCCATTGCAGGTTTTGCGGGTGCCTTTATTAGTTTGCCGTTCGACTTTGTT
AAGACACGGCTACAAAACCAAACAGCAACCGGCGGAAGGGCAAACGAGTTGCCCAATTACTCGGGCACGTTTGACTGCTT
GGCCAAGGTTATCCGCCGAGAGGGCGTCATTCGCTTCTACCGCGACTTTTGGCCATATTTTTTTCGAATCGCTCCGCATT
CGTTAGTTGTCCTCCGCACTAGATGCCTCTTTTCTGTATTACACCGCAGTTTTTGTGGGTTATACTGATGACTTTTCAGG
GTAGTAGCCCTGTTTCTCGCAGATCAGGCAAATGAGCTTATTTTAAAGAAAAAATGGCTACAGACCTACAATAAAGATAT
GAAGGCGGCATAGGCACGCGTCTGATCTATTTCGTGGTGCCTACGGGATGTTCCTGCATATGGGACACCGAAGTCTCTTG
CCGGCGCATCTTTATGGCCGGACAAGAAAATAGCCCGTAATATATTCCAACTACTGCGCTTAAAATGCCCTTCGATCGCT
GCAATTATAAATATTATCCTAGGTTTTGCTATCTTCGCCTCGGTATATTGGAATTATTAGCAATCTTCAGCAGTGTCGTA
GTGGGTGCCTCCGCGTAAAATTGGAGAATTATTTCTGTACAGAATACTATTAGCGCATCAGGAAAGTAAAGCGCCTTAAA
CCCCGCGCGAAGACCACCGTGTAGCATGTGCTTATAAGCAGCAACATGAAAAGAGCCCGTCGTATGAAAACTACGTGCTA
ATAATATGGTGATATTTGTAACGGCTGCGCAGAAACGCACGGCCACGTAAAACTAACAAAATTGGGTGTTATGCCGTGCC
TAGCCGCCGAACTTGGCAAGCCCTACGGAATAACGGACACATTGCTCCAGGTGTGGGTAATAGATGACTTTTACGTGAAT
AGGCTGTGGCTTCTACTCCGTGCACCACTAGTCTGTACGCGCAGTCGTCTGCGCGAATACCAGTGTAAGACCCGTACATT
AATCCTTGTGGGATATTCGTCCGGACCAGTTACACGTATCGTAGTAAGCTCGAAGGCCTTCAGAAGATCTAGTGATGATA
TTTCGTAGGGTGGTTGACTGAAGCTCCAGACTGTGCGCAGTGTGTGCGCTCAGATCAGGGCTTCGTCTTATCTAGTGATG
TCGGCGGCCGAGGTCAGGTGACCTCGGGAAATCCACAAGGCGGAAGTCTTCGCATGGAATATTCCACAGATAAAGTGCGC
CAAAGTGGTACTTTATACCCGAGGCTCCGTCCTCATCAAAAAGTGTTGCCGAGGGTAATTTGAGCTCTCCTCTTTCCCGC
CTTCCGTCTGTTACGGAATCATTTGTCAAAGAAACACCCGGTTATTAATAGTGCGGTCCATCACTTTTAGTAAAATATAT
ATACGATTGGTATGAGAGCAACTGACGTAGATGAATTATCTTTGCACCAAAAAGGCATCAGCATGTTCCGTATATTGGGG
CGTTCGATGTAAGATACATACGTCGTAGGAAGACTGAAGGCGTTGCACAATTAGTGGATTTTTCACCGCAGACCAACAGC
CGAGAAACCCCATACAGAAACCCCGTACAGAAGCTATTTTAGAGCCCGCATTAGTGTGCGGGGGCGGAGTCGCCGTGCGG
AGATCTAAACGTGTTGTTTGGTTCGAACTGAAGAGGGACAGGAACGATTGAAGGTGCTTCCTTTCTTGACGCAGTTCGAA
GGGTTCCTTTTTTTCCTCTTCAGAGATAGACACCTTTTTTTTTTTTTGCTTCCAAAGAGCCCTGTGCATTGTGTATTGTC
CCTACGACAATGGCGCCTCTACCTTTGCCCTCCATCACAGCTGCCATGCAGGGCAGTACCAGTTCTGAAATAGCTGGGCA
CTCCGGCCGAACGGGAGCTGAAAAGCGCCCAGCGGTGGACTGCAGCATTGATCGTGTGCCGAAACGTCGTTCATCCAAAG
CATGCCTGTCTTGCCGCAGCCGCAAAGTACGGTGCGATGTCATCATGGGTGGGCAGCCGTGCACGAACTGCCGTCTGGAT
GGTCTGCATTGCATCATCAAGGAGCCCAATCGGGGTCGGAGACCGTCCGGGGGCCCATCCATAACTTCTAGGTCTGTGAC
GACAACAGCGTCGTTAACGGCATCGTCTTCAGCAACGTCGGATCCAACCACAACATCCACACAAACAACAGCGACACAAA
ACGAAATCAGGACACCCGAGGCCGTAGCCAGCTCCGGCACAGCAATATCAAGTTCCGGTGCTGCTGTGATTATCATAGGC
CGGGAAAACACAATTCCTGGTTCGTCATCACCACTACGGATCTCGCCAGCGCCGGTACAACGGCAGCGCGCCGACTCGGA
GCGAAGTGTACCCGACGACTTTTTTGTATCTCTTTCGTTTGAAGGTATATATTTTACGTCACATGGCATTGCTACGTTGC
GATCAAATACTGGCTCATTACTGATATGGTTCTGCGACTGCAGATCAACCCTTACCGCTCAATAGCACCCCAGAACACGC
GGCCGATGAAAACCGACTGTATTCCCAGGAACCCAAGATCCAGCATGGCCGAAGCTCAAGGGAAGGAGATACAACCATGG
CAGCAACGACGTCGCCAGAAATATTGATCCCTATGTCAGCTTCCCATTCCATTCACGATACACCGCCAGCGTCATCTGCT
TCTCACAGATTGCCGCCATACATTCGTCCTCTCAGCAGCCAAATCGATTCTCGGGATATGGATTACCTCGCTGACAAAGG
CGCGCTCACTATCTTGAATGACGAGTTTCGCGACGAGCTTTTGCGCATCTACGTTAACTTTGTGTATCCATTCATGCCTG
CCATCGACGTTAAAAGCTTCATCGAGTCCATTATGCAGGGCGATGGAAGCCGTCCTGTCAGCCTTCTTCTCTTCCAGGCA
ATCATGTTTGCTAGCGTCGCTTTTGTCGACGTCAGATTCTTGAAAGAAAATGGCTTTCATAGCCGCAAAGAGGCACGGAA
GACCTTCTTTAGTCGCGTCCGGCTCCTCTATGGGTTAGACTGCGAGCCCGATCGCATCTCTCTGCTCCAAGCTGTGCTCC
TGATGACTTACTGGTACGAGTCTCCAGACGATGACAAGGACACTTGGTATTGGATGGGTGTCGCCCTGACTATGGCTCAA
GTCGCCGGACTGCACCGCAACCCCGAAAGTTTAAGGATCCCAATAGAAGAAAAGCGCCTGCGGCGACGGCTTTGGTGGTC
GTGTGTCATGCGCGACAAGCTTCTTGCCCTCGGTATTCGGCGCCCCGCCCGCACTCTCAGCAACAAGTTCGACGTTCCTA
TACTTGCATTTGATGACTTCGACCTCAGCGCTCCGTCTGAGCCTCTCTGTCGCCTTCTTGGCGAGTCTTCCCTTGTCCTT
CCCGAGAATGAGGGCCGTGAAGTACTGGCTGGTATGATCGTAGAACTCAGCAAGCTCTGCGTCTGTCTTGGTCACATACT
GCGATCTCAATACACTGTCATGGGCAGCCACCCAGCGGGCTCGGAGTACCTCTTGAAAGCCTTGGTTGTTCCGGAGAAGT
CGGAACATCAAGCTCTGGAACTGGCAGCATGCGACAAGGAGCTCACAGACTGGTTACAGAGCCAGGACTCTCGATACAGG
TACAGCTCAGTGCCGAGCACGCTTGATCCGCCTGTCATACATGACAGCTTCGGGCAGGTCATTCGATTGCACCAAGCATT
GCTGCATATGATATACTTGACAGCTCAGAGCGTTTTACACAGGCCACATGCTGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62