GenePrediction:GLEAN_4426 Details

Name: GLEAN_4426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:899988..899177 (- strand)
Length: 812
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:899988..899658 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_161:899565..899177 (- strand)
Length: 389
>GLEAN_4426 class=GenePrediction position=GCSC_161:899988..899177 (- strand)
ATGACCAAAGCAGGAAGACAAACGACCAAGAAGTTCTTCTGCTTGTGGTGCAACCATGGTGGGCCGCCTCGTCTCTCATG
TGCTTCGGCCTCGTGTTGGTTTGTCCCCTGTGCATCTGCATTCGCCCTGGTCACTCACCGTCCTACAAGGTCGCAGCCAG
TGCCATCTCAACACCATACGCCATGTATCGTGCTGCTCGCACGAGAAAAAGAAAAAGCAGTTGCATCTACATCACCACAC
AGCCAAGCCCGTCCTACGCCTGACTTCTACCGCATTCTGGACGTCGACCCCGACATGGAAGCGCGCCTCTGTCAACACAC
TGCGCTGCCTGGTGGGCTGCTCAGCAGGCGACCTTACCGCTATGTGGATACTGCAAGCCCATTTTTCCGGACTTGGCATG
TGGCCGATCATGGCAATATCCAGTTAGGTTCACCCCAGATTGGCCGTACATACTCCGTACTACGAGCAGGATCGATAATC
TGACGGCAGCTCCTGTTCGCCAACATCCCTTCCCCACAGTCACCAGCGGTCTAGCGTCTTCCATAGCCCTTGAAACAGTT
CTTCTCCGCTTCGGCCGTGACAAGCTCACCTGGCTGCGGGCAGCTCAGACCGCTGTCGGTATGAGCTTTATATCCATGAT
CACCATGGAGATCGCAGAGAATGCGGTGGACTATCACCTGACTGGAGGCGCTGTGGCACTTGGTGATCCTATGTTTTGGA
CCGCAGCAGCCGTCGCCATGGCCGCGGGCTTCATTGCTCCGCTTCCCTACAATTATATTCGGCTACGCCGTTTCGGCAAG
GCTTGCCATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62