GenePrediction:GLEAN_4428 Details

Name: GLEAN_4428
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:894107..893030 (- strand)
Length: 1078
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:894107..894006 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_161:893879..893725 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_161:893627..893532 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_161:893414..893030 (- strand)
Length: 385
>GLEAN_4428 class=GenePrediction position=GCSC_161:894107..893030 (- strand)
ATGCGACAGGAGATAGGGGAGGGCCTGGTTGACACCCCACTAGTAGAGACCGCGAGCCAGCTCGTGCAGGGAGGTGGCGT
GGCCGGGGATGTCTTCGTCCGGGTCTGTTACCATGAGTTCGATGTCGCCGTCTAGCTGCACTGTCAAACTTTCAGGAGCT
GCTCAGGAGAGGATCATTGGTGGTATGGAAGCGAAGTCCCTTCTCCGTACGAGTCGCTCTACGAACAGAGTCTCCTGGCC
CTATGGCGGATAGCTGTCGTCGCCGACTTTAGTAGCGTAGCCATTACTGCCCCTGTTAGCGACGATGTGGCTTCGGCAGA
GATCTGGTGTTTTGTGTTTTGCGGACTGCGTCTTATTTACTATGGGGTTGTGGGCCTGATTAAGTTAGTCCGTTTTATGC
TTTTGGATTATGGGTAATACTCCGTACCTAGTGAGTGTATCTTGTCCGAGACGAAAAAGCAACTACACCGACCCCATAAG
CGACGGCTACGACAAGAAGTTCAAGGTATACGCGAAAGTGGTCGCGGGCGGTGCTGATTTGCAGGTGCACGACTTTATGC
AGCAGATTGGCGACAAGTACGTTACCTGCCTAGCCACAGAGGCACGGATCTGCTGCAAGGAGTGCTAGAGCAACTTGCAG
AGCGACAGCTACTGCGACTACTGCTTCGATGACAAGTCTTGCTACGTGAACAGAGATTCGCTGGACAAGAGTGACGGCTA
CAATACAATGGCCAACCTAGCGCTCAACATGAGCTTTGCCAGCGAGTCGGAGCCGTGTCCGGGTGACTTCTCCGAGCGCG
GCTACGGGCCCGACTGCCTGTACGAGCAGACAGTCTACTGGACGCTGCGCGATGACCAGGCGGACGTCTTCTATGCCAAC
TTGGAGAGCGCCACCGGCATCCCCAAGGACAAGATCGGCTTCGGCTACTACACCGACATCGACAACTGTAGCGGCAGCGG
CAGCAAAGTCGGCGACGGCGATAACTGCTGGAACATCGATTATGAGCTCGGCGCGCCCTTCCCCAACGGCTACGGCACCG
ACGACGTGGCTAACCCTAAGGATGTGGCCAAGATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62