GenePrediction:GLEAN_4429 Details

Name: GLEAN_4429
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:891200..888591 (- strand)
Length: 2610
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:891200..891050 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_161:890966..888961 (- strand)
Length: 2006
Type: CDS
Source: GLEAN
Position: GCSC_161:888644..888591 (- strand)
Length: 54
>GLEAN_4429 class=GenePrediction position=GCSC_161:891200..888591 (- strand)
ATGTCCACTCCACAAGATCCGTCTCCCGGCACCAGCGGTGGCTACAAGCGAGCCAGCCGCAAGGGCGCCCCTAGACGTTA
TGCGTGCCAGTATCCCGGCTGCGACAGGGTTTATTCTCGACAAGAGCATTTGCAAAGGCATCAGCTGAACCGTACGTTCA
CCACAGGCTTGGCAATCTTTGCTGAAAGCTGTCGGTTTTTCTTGCCACTGATTCTAACCACACTATCCTTGCAGACAACC
CTACAGAAATATTTATCTGTGATAGGCAGGGTTGTACGCAGAGGTTCGTTCGTGCCGACCTGCTGGCTCGTCACAAGAAG
CGCCACTCTGGTTCGTACACTCCCCGAAATCGAATCCAGAGCTTTAGCGATCCTCAGAATACCTCTCTTGCGCCTCCTCC
TGCCGCACCCCTTCTGCCTCCGAGAGAAGCGAAGGACTCTGGGCCTGAAGGAGAACGAAGAAACGGGCCGGAAAGCACAT
CGCAAACTTGTACATCCACAGCTCCTTCCATTTCGCACCCATCAGCGAGTGTTCCCCATGATGCCGCTATCCTGTTGACC
CCAGAGTCGAGCACCAACCAGCCTCTGCCACAGAGTCAGACACACATCCAACCCCACAGCCTATCACAAGCATCACCAAC
CGAGACTGATTGGACTACTGGTGCACTTATGAGAGATCCAAGAGCGTGCGACGTCCGCCGCCCAAAAGCAGGCACCATCT
ATCCTCCATCCCCCCAACAGCAAATTACTCCACATGTGGCGGACCTTCAGCATCATCATGTCCATAGCCACGGTCAAGAA
ATCCAGGAGACGGCGCCTGGCGTGATGCCTTTCAACGCCATGCAGTTCATGGACTCGACCCTTGTACGAGATTACTTTAC
TTCGTGGCTTTTCGATAATCAGGCGTCCTTTAGCGATTTCAATATCGGACAGCTACCATTCCTAGAAGGTGGTCTCGAGT
CACCTTTCAATAACAGTATTCATTATGACTACGAGTCATTGACAAGCCACTCGCACATTGACACACCGCCACGCCTGCCG
GACATCGACGAAGGCATCTCTGAAATACGCCGACAGGAGGTTCTGCGGGAGTTTGAACTGTTCCGCGTCCGGCGATCTCG
CACTGAATCACAAATGCCAGACCTGGATGGTGCCACTAGCACCGGAGGTCTCTCGATGCCGACCCTAAAAGTGATGAACG
ATTGTCTCAATGCCTATTGGGAATATGTGTCGCCGCGTGTTCCCATTGTTCACCAGCCTACTTTCTTCTGCAACACTTGC
CCTCCGCTACTACTTCTCGTTGTTCTTGCACTTGGCGCTGCAGCTCTTCATGGCCGCCAAGGAGTCGCCATTGCATCCGA
AGACTTTGCGGAGCTTGGCGGCTTTGCCGATAGCATCATAGTGAGTGCACGATGGGAAATATTGACAGACGATGAGGCAT
CACCCCCTGTTGCTCTTTGGGTGGCTCAGGCACTTCTTCTCATTGAATTCTACGAGAAGATGTACTCAACTCGCCGTCTC
CACGAACGCTCACACATCTATCACTCGGCAACCCTGACTCTGCTGCGGCGAGGCAGTCCGCTTATTGGCCGTTCTGGCAG
CGAGTCGCCTCCTGACGAGGCTCTTATTTCTTCGGCTACTAATGCGCCCCTGTCATCTGCAAATCACGATGATCACCGGC
AACGGTCACTTGATCATCAACAACAAAGCAGTGACTGGCATGCTTGGTGGACACACTGGGCAGAAAAAGAGGCTATGCAC
AGAGTCGTCTTTGCCGCCTTTTGCTTTGACGTCACACATGCTGCTATGTTTGGCCATGCTGCCGACATGGCTCCTCACGA
AATCCGCCTGCCTCTCCCGTGCGATGACAATTTATGGACGGCGTGGAAACCCGACGATGTGCGCAAGTACGACGCAGACT
TACGCATGTACGGTGTAAAGCCTAGTTTCTTCTTGGATGGACTGAAGCGTGCTCTCCATGGCCAGGAGGTGCAGACGCAT
AGCTTTGGCCGCATGATCATCATGTGCGGGTTGCTGAGCGTTGGCTGGCATTTGAACCATCGTGAGAAACACGTCACGTG
GCTAGAGCTGAAGACATCGTCATCTGAGGCGCACGAAAAATGGCGGGCGATTTTGCTCAAAGCCTTTGACAACTGGAAAG
AAAGCTTTGATAGGGCCCACGGAGCCTTGGGTGCTATGCGGCCTGAGCCGGCCGTCTTGTCGTCTGTTTCGGCTACTATT
GTTCGTCGTGGATGCTATAATGGACCTATCCAAAGTGCAGCAGTCCTTTACCACCTTTCCCATATCAGCCTGCACGTCGA
TATAATCGACTGCCAAGTATATGCAGGAGTGCAGCGAGTGCTTGGCCGCAAGATCACAACAAGAGACTACGCCAATGTGG
TCTCACGAATGAAGAAGTGGGCTACACAGCCATCAACGCGCCACGCCATCTTGCAAGCTTTTCGCCTACTGCACCATGTT
CTTGTCCAAGTGCCAGAATCGGAGAAGAGCCGCCATTGTCCGCCTGGATCTAATCAGATCGACTTGCCGCCTATAGAGAA
CCCGGGCTACTCGTGCAGGACAGAATCCGACCCGCACCGGCCCTGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62