GenePrediction:GLEAN_4431 Details

Name: GLEAN_4431
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:873994..872298 (- strand)
Length: 1697
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:873994..873903 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_161:873831..872298 (- strand)
Length: 1534
>GLEAN_4431 class=GenePrediction position=GCSC_161:873994..872298 (- strand)
ATGTCGGACGTAGTGACGGTAGGGTTTGCGTGCGTGTTTGGAATCTGGAGCTGTGTGGTGCTCGTGGTGCAGAGCATTGG
TATCTTTCAAATGTGAGTGATCCCGTCAAGCTGGCCTTCTGGACTGCTGAAGGGCTTGCTGGCTGGCTTGCTGACCAGGC
CAGCTTCCGACAGTACTCGAGGCCACCGAGGCGGGCAGCCGTGGAGGCGCTTCCTGACGAAGCAGTGCCTCATGTGACGG
TGATCCGGCCGGTCAAGGGCTTGGAGCCGGCGCTGTACGAATGCATCGCGTCGACGTTCCGGCAGTCGTACCCGCGGTCG
CGACTCAGCGTACATCTGTGCGTGGAGGACCGGGACGACGCGGCGCTGGCAGTGCTGGAACAGGTGGTGGCGGACTTTCC
AGGGGTGGACGCACGGATCTACGTGGAGGCAGAGGATCCGCTGCTGCACGGAGCCGACGGCCATCACAACAACCTGGGAC
CGAATCCCAAGATCCGCAACATCAGCCGGGCATACCGGGAGGCACGCGGCGACATTGTGTGGATCGTCGACTGCAACGTG
TGGGTGGCCGAGGGCGTGGCCGGGCGCATGGTCGACAAGCTGTGCGGCATTGGCGAGAACGGGACGCAGGCGAAGCCGTA
CAAGTTTGTGCACCAGCTGCCGCTGGTCATCGATATTACGCGTGGGGGAGAAGATGAGCAGCTGCAGGAGAGCAGCGCTA
CGGTCGCCAGCCGGATCTCACGGCTTCTTGCTGGCGGTGGCGGCCGGCTGGACGAGATGTTCATGGCGACGACACACGCC
AAGTTTTACTGCGCAATCAACACAGTCGGCGTGGCGCCCTGTATTCTGGGCAAGAGCAACATGTTCCGGCGGTCGCATCT
GGACCGGCTGACGGATCCGGCCTGCAATCCAACCGTTCTCTCGGCGGCCGACAATGACCGTGGCCGCGGCATCGACTTTT
TCTCGTCGTACATCTGTGAGGACCACCTGATCGGCGACCTGCTGTGGCGCTCACCGCTGCCAGGTTTCCGGAATCACGGC
CTGGCAGCTGGCGACCTCGCCCTGCAGCCCATGGCCGACACGTCCGTCCGGGCCTATGCTGCCCGCCGTGTCCGCTGGCT
GCGTGTCCGCAAGTGGACCGTCCTGCTGGCCACTCTGGTCGAGCCGGGCGTCGAGTCGATGCTGTGCTGCTTCTATGCCG
CCTTTGCCATCACCACCCTGGTGCCACGCGCCCCAGCTGCCTCGCTGCTCGGTCGTCTGGCTGCTCTGCTCGCCATTCGA
CCCGTCTGGACTGTCACTCTGCGCGGTTGGCTCGTCGGTGTCGCCGTCTGGCTCGTCGCCGACTGGTTCACGTCCAACCA
CCTGCTCGCCTGCCGTCCCGTTGATGTCGACCTCGCTACCACCCCTCGCTTCGCCCGTGGCCGTGGCTCGACTGCCCTTC
GGCGCAACGGCCGCCCCAGACGCCCTTTTGTTGTCTGGCTCGCCGCCTGGCTCGGCCGTGAACTCCTCGCCCTCCCTATC
TGGACCTGGGCCGTCCTCCTCGGCACTACCGTCTCCTGGCGCGGCAAGCAGTTCCGCGTTCGCCTAGACATGTCCGTCGT
CGAGATCGATGGCAACGGCAAGGCCATCTCTTCTTCCGATCCAGAACCCGTCAGAGACTCGGTCGCTACCAGGACCTCAA
AGGCCCGTCTTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62