GenePrediction:GLEAN_4432 Details

Name: GLEAN_4432
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:869744..866413 (- strand)
Length: 3332
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:869744..869401 (- strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_161:869341..867851 (- strand)
Length: 1491
Type: CDS
Source: GLEAN
Position: GCSC_161:867553..867019 (- strand)
Length: 535
Type: CDS
Source: GLEAN
Position: GCSC_161:866958..866413 (- strand)
Length: 546
>GLEAN_4432 class=GenePrediction position=GCSC_161:869744..866413 (- strand)
ATGAAGCCGCCCCAGTCGGGACCAACGAACGGTGACGTTCGGAGTCTGTCGTCTAGGACGAACAATATCCCCACCCCGAA
ATATCTTCTTCCGATCCCGTTGCGCACTTTTCCACTGCCAACATTCTACCCCAGCAACCCAGTGTCGCTGTTGCACTTGG
CTATTGCGTGGGTTCGACAGATCGTGTACCCGCCCGCTGTCGAGCCATCCATCGTCCACGAGGGTGTTTGGTCGCCTGAA
ACTCGTTCTGTGCACGTCACGGACTCAACGTCTATGAGCGACTTGTGGTGCCAAGGTTTCTTTGGGAAAGGCTCTCTCAG
CCGGAGCGAACCAAGCTGGCTACAGTGCGTTTTTTCCATAGAAAACAACCCCAGCTCTCTAGCGGAGGCTAACAGAGCCA
CAGGCGGCAACTTGGCGAAACCAGTGAACAACGCACGGCTAAACGTCGCGAGGAGCGAGCCAGCACAAAATGGGAACGTG
GCCGGTCCGAGCTGGAAGCTCTCGAGCGGAAACGCTACGAAGAAGAGGTTGCTGCAACAGCTGCACTTGCACTTCAGCGA
CAAAAAGAACAACCGACCGTTCTCAAACAGGAGGAGGAAACGCCTACCATCCCTAGTCACGCCGACAAAAGCATCCCAAA
GGAGAGCCTGGGCTCCACATTCAAAGCTCCAGTGGGCCCGTTAGAACTTTTGGCACTGCCAAACTCACAGGCAGACTTGG
TCCAGGCATTGTTGGTAAAGCCTGGCAACGAAGACCCATCAAACGGTTGTGTTGCAAGGCCTTTGTTCCGGCCACCAGTT
GGCCCCCTCGAGCTGCTGGCCCTCCCAAATTCGGCGGCGGACTACCTCAAGGCGTTTCCTCCCAAAGCAAAGCTCAGTAG
GCCACATCCGGCTGCCACAGAGTCCTGTGAACCTTTTCAGTCGTGCAGTCAGCAGCCGTATCAGAACGGCAGGTCCTCTC
TGAAGGGCACTCCGGCCAATGGTACTGGAGCCAGTGTGAATGGCGCCTCTATCGAGCCTATCTCCCCAGAACAGAAAGAG
GAAGGATGCAGCGGCAATGCCATCGACGGGGAGCTTAGTGACACACTCACACTGAAGCGTCAGAAAAATGTCCGATTTGC
TGCGAACGTCGAATCCACGACGTTCCAGTGCTCGGATCCGCCCAGTCCAAACCACATCCCGTCAGCAACGTCTGCCAAGC
AGGTTAGTAGTGGTCAGGCAATGAATGGGAATTCAGGAGCACCGGCAGACAACGGTGTTGCAAAGTGTACTGCCCCCTCG
CCGACAGAACAGTCTCCGCGCGATGCAGACAAGAAAAAGAGCGAAGCATTAACAAAAGGGATGGAGCTGCCTATGGCGAA
CAAGGAGCATCTCCAGCTGTCTGCGGAAGAGGCCTTTTTTCTCGCTTACGGCCTGGGTGCCCTGGTCGTTACCGATCCCG
AGACCAAGAAACCCTTGACGACGGCAGAGCTGTTTTCGTTGTGCCGGCAATTTTCGTATTTTCCACCTCGGACGCCGAAC
GCGCTGTCTACAGACGACCCGTTCTTAGTACATTACGCCGTGTACCACCACTTCCGGTCACTCGGGTGGGTGCCGCGTCA
CGGCATCAAATTCGGTGTGGACTGGCTGCTGTACGGCAAGGGTCCGGCGCTTGACCACGCCGAGTTTGGCGTCATCGTCA
TGCCGTCGTATTCAGATGCCTGGTGGAAAGCCAACGGTCGGGAGGCGCCGCGCAAGTCATGGCACTGGCTGCACAGTGTT
AACCGTGTTCTGTCCACCGTATTCAAGAGTCTTGTGCTTGTCTACGTGGACGTGCCTCCGCCGTCGGCGGTTGGCGATAG
CGCATCGGACCTTCTGCAGCGGTTTCAAATTCGGGAAGTTATGGTTCGGCGATGGTCCAGCAACCGAAATCGGGATTGAA
CATGCTGCAAGACGGCTGAGCATGGCGACTTGGGGCCAATCTGCGGCTTGTTCAATATTGTGCTTCAATTTACTAGTACC
ACTCAATCGATTTACATTCTTGAAGCATGTTTTCAAAGACGGACATAATTCCATCTCATGGTGACAGTATGAACATTGCG
CACACACGGCCAATCGCACGGTCATATGACGACACGATTACATAATATGGCCTTACCATAATATGCATCTTATGCTGTCT
CATCTCATCTCCTCACTTCCCCTTTCGCCAGCCATCACACCTCTTTCGTCCAAGATATTCCCCCATTTGAGACGACTACG
CCGAGACGGTCGATAATGGCACCTTATTTCCTATTGCACGACGATAACGACGACCCCGGGCCGTACTGGAGCGTCGTGCT
TCACGTCATAGCCGTCTTCACCTTCGGCTCAATTCTGTACCTGGCTCGGGAGGCGAAACGGAAGCAGCAGGAGCTGGACC
GGCTGAACAGACTGGCCATGTCACAGTCGCCGTCACGCTACACCGACGACAAGGACAAGCAGCTCGTCCAGCCACCAGAA
CCGGAAACTCCTCGTGCTCCTCCTCTCTTCCTCCTCGTTGGCGACTCCACCACGGCCGCCCAATCTGCTGGTGGCGGTGG
CTGGGGCACCGGCTTCCTGTCGCTGCTGGCCCGTGGAGCACACGGCATCAATTACGGCCGCAACGGCGCCACCACCCGTG
ACTACATCAAGTATGGCATCTGGGACGAGGTACTCGACCAAGTGTGCCAGGCCGTGCCCACATCTCCTGTGCACGTGACC
ATTCAGGTATGTTGTTTTCCGTGCTATGTATCGCCTTGTTCCTTCTTCCCTCTGACCGGCTCTCAGTTTGGCCACAACGA
CCAGATGCCCTCTCGCGGCGTCTCCCTCGACGACTACCGCCAGCTCCTCGTTCGCATGGCCCGCGATGTCCTCGACGCCG
GCGGCATCCCCATCCTTCTGAGCCCGCTCACCCGCCGCGACTTTGACGCCGACGGCGCCGTCGTCGACAACCTGCGCGAA
TACCGTCTCGCCACCCATACGGCCTTCCAAGAGGTCTCCAGCTCCCTCAGCTCGGCCGACGGTGGCCTGCGTCCCCGCTT
CTGCGATCTCAATGCGGCCAGTCTCGCCTATGTCGCCGCCCTCGGCAGCGATGCCGCCCAACAGTATAACCTCACCGACG
GCGACACCACGCACCTCAGCCTTCACGGCAGCACCGTCTTCGGTCGCATGGTCGCTGACCTGCTTCTGGGTCACCCGCCC
GCTCTGGTCAAGTCTGGTCACCGCGACAAGTGGGCTCCCGGCAGCCCCAAAAACGACGACGGCGGCATCGCCGACTGGAT
CAAGCCCAGCCCGCTGTTGTCCGGTCAGATCTGGCATGGCCTGCCAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62