GenePrediction:GLEAN_4437 Details

Name: GLEAN_4437
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:841171..840084 (- strand)
Length: 1088
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:841171..841124 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_161:841001..840576 (- strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_161:840452..840084 (- strand)
Length: 369
>GLEAN_4437 class=GenePrediction position=GCSC_161:841171..840084 (- strand)
ATGGAGAAGGCCGCCGAGAACGAGAAGACGCGCAAGTTTGCCATCCTCGTGCGCAACAGTGTGTCTCGCTGACAAGGCTT
GTCCGCACACAGGAAAGAGCGAGGAATCGGACAAGGCACTGGACGCGGCCACGCGCGCGCACCTTCAGATGCTACACGGC
CTGCTCACAGTCGAGCTCGGCGACGTGCTCACAGCCCTGCAAGACTACGCAGCTCACCGTCAACGGCCGCATCATGGTGG
ACGCGCTCACGTACACGACGAGCAACAGCAGAGCCATCGCACTCGAGCCGCTAGAAGAGGTGGAAGAGCGCGGCCCTGTC
CAGGACGAAGACGAGGACGACGGAAGCTTGCGCCGCCGTGTTCGCCGTGGTTCGAGTACGCGCCGGCGCTACAGCCACGA
CAACAACAGCTACGACCCGACCGTTTCCGAGATCCAGTTCCGCGAGCAGGCCGGCAGCGTCGAGGTCGGGGTGGTTGGTG
GGATCCAGAAGACGCGATTCTTGCCACTGACGACGGAGCAGCTGCTGCTATGCACGCCCATAGTCAAGGGCTTCGACCTG
CGCAGCAAGAAGTGGCTTGAGTTCTTCGTCGACCAGGTGACTGACGTGCCCTTTTAACCCGCAGGCCTTTGACTGACTGG
TGCTGCCCGAGGGCCACAAGAAGCTCGTCTTGGCCCTGACGCCACCGACATGGGTTTGAATGCCTGTGACGTCGAGTAGG
CGCTCGAGGTGGCCTTTCGACTGGTCGCCAAGTGGAAGGCCGTGCTGCTGATCGACGAGTGCGACATCGTGTTCGAGGCC
CGCGACGTCAACAATGTCGACCGCAACGGCATCGTCTCCATCTTCCTGCGCACGCTCGAGTACTACCAGGGCGTCCTCTT
TCTGACGACAAATCGCCGGGGCAACATTGATCCCGCCTTTCGCTCCCGCATCCACGTCCACCTGCACTACCCCGGGCTCG
ATAGTCTGGCCGAGCTGTCCCTCAACGGTCGCCAGATCAAGAACATCCTCAAGACGAGCGGCCTGTTGGCGTTTCAAGAC
GACGAGCCGTTGGCGTATGAGCACATCCGCACAGTTCTGTTGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62