GenePrediction:GLEAN_4438 Details

Name: GLEAN_4438
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:839762..839292 (- strand)
Length: 471
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:839762..839715 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_161:839648..839588 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_161:839533..839292 (- strand)
Length: 242
>GLEAN_4438 class=GenePrediction position=GCSC_161:839762..839292 (- strand)
ATGACGTCCACCATCGGCATCCCCATCAAGCTCCTGAACGAGGCTCAGGTTGGATCCCTTTGCAGCGGATTGCCTTCTGC
CATGTGCCCAGATCTGTGCTGACTTCTGTCCTAGGGCCATATCGTCACGCTCGAGATCACGTCGGGGCAAACGTACCGCG
GCCGCCTGCTGGAAGGTAAGACCCTGTTGGGGTATCCACGATCAGCGGGCCACACGCTAACCAGACCAGCCGAGGACAAC
ATGAACGTCCAGCTCAAGGACATCACGGTCACCGCGCGGGACGGCCGCGTTAGCCATCTGGAACAGGTGTACATCCGCGG
AAGCCACGTACGGTTCTTCATCGTGCCCGACATGCTGCGGAATGCGCCCATGTTCCGCAGCCGAAACGTGCGGGGACGCG
GTGTCGGCCTGGCTCGTGGACGGGCTACAGTCAGCCGTGCACGAGCAGGAGGCCGTGGCGGACGGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62