GenePrediction:GLEAN_4439 Details

Name: GLEAN_4439
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:836745..833666 (- strand)
Length: 3080
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:836745..834239 (- strand)
Length: 2507
Type: CDS
Source: GLEAN
Position: GCSC_161:834140..833849 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_161:833767..833666 (- strand)
Length: 102
>GLEAN_4439 class=GenePrediction position=GCSC_161:836745..833666 (- strand)
ATGGACGACCTCTCGGGCCTCGACTGGTCGGCTGGCAGCTCGGCCACCAACAAGAGCAGCGCCAAGCCAACGATAGCGGC
CTCGTCAGCTGCCTTCTCGACCGGCGCTTTCCAGTCGTACCCGCCACTTCGACCCGCGCCATCGCCTCTCGCGTCCGGCC
GGAACACCCCCCTTTCTTCACAAACATCGGGCATTGCTGCTGGAGCGGCCGCGCCCAAGCCGACGGCCGTTGCGAAACCG
GCACAGGACAGCTTCAGCAACCTGATCAGTTTTGGGTCTGCCAAGAACCCCGCCAACCTCAGCCTCCGTGAGCGGCAGGA
GCTGCTGGAAACCGAGCGGCGCAAGAAGGAGGAAGAGAGGAGGAAGCAGCACGAGGCAAACTATGGAAATGGGCAGTTTT
TCGATGTCTTGGCTCGTGGATCAGCTGGTGGCGCGTCGAGAACGGCGTCGCCCGCAGCAGACACAGACGCCGATCTCTTT
GCCGCATTCAACGCCAATACCAAGGTCGACAACTCGAGCCATTTTCCTCCTGTAGGAGAAGCATCTCGCAAGTCGACACC
AGCTGCCGCAGCAGTTTCTCCGCCCCCTGGCCTGGACCTCAGTAATCCCAACGCTTGGAACACGAACGCGCCAGGGGGCA
GTGTCAGTGCTGCAAACGATGACGATGATCCCTTCGGGCTGAACCAGCTACAGTCTCGCCCGGTTGGCCGTCCTGCTGTT
CCTCCAACGTCTACCGGCAATGTCACAGGCGATGGGGACGACGACGACTTTCTGGGCGACTTGGGTCGGCCGGTGGAGGA
AGTTCGGCGCAAGGCAGAGTTGCAACAGAAGCGCCATCCCCATTCGGAGCCGGGGAAGCCCATTGAGGATTCGAGCTCCG
ACTCTGACGCGGTAGCACCGAGCGGTGACGATGGTCCAAGAAAGACGGGCAACGTGGCATTCGACAACGCCGTCGCACAG
CTCGTGGACTATGGATTCACTTCGGAAAACGCCATGAGGGGACTGACCGAGAGCGGCGCCGGACTGAACGTGCAGGCAGC
CGTCAATTGGCTGCTGGACGATGCGCATCGGCAGGCGAAAGAGCAGGCGAGGGCGAAGCAACGTGGCGGCGGCGGCGGCA
GCAGCGACCATCCAAGAGCGTCAGACGAAGGTCGGCCTGGAGGCCGAGGCCGCCAGACTGGCCCAGCCTGGATGAGAGAG
GACGACGAGGAGGCAGCACGCCGGAGAGGCAGCCGGTCGCCTGCGGTGCTGGGCGACGGCGACCTTGCCAAGACGGCAGC
GGCCATCGGAACAAACTTTCTCAAGACGGCCAACTCGCTGTGGAAGACAGGACAGAAGCGAATGCAGCAGGCCGTGCAGG
AGTTCCAGCAGGAAGTAGATCCGAGCCAGCCGAGATGGATGCGCCACGACGACATGGGCACGCCAGCGCCGCCAGCTGAC
CACAGCAACGCACAAAGAAGGGGGCCTGCTGCGCTGCCGACGGCCGCCGCTCCGGCAGCGGCAATAGCGGCGACAGATGA
AGCCATCCTGCTGGAGATGGGCGCCCGGCCAGAGCGCAAGCAGCCACACAGTCGGCCTGCGCCGCCAGCAGAGCCTAGAT
TCAGGGAAGGCAGCCAGACCTCATCGCGCACACAGTCTCCAGCTGCTGCTGGCCTGAGCTCTGGCTCAACCAGGCGCGGA
AGCCCTGCTCCACGATGGCAACAAGGCAGCGGTAGTGGTGGCGGCGACCCGCGATCACGGCTGACTAAGCAGGCTATTGA
GGAGGAAAGCGCGCAGGTGTACGTCAGTTCGCGGCGGCGAAGAACCCCGGGCACACCGGTAGGAGCGGCAGGAGCAGCAG
GTACGCCACCGCCACAGCGAACAGAACAGGCGCAGGTGCAAGCTACGGTGCAAGAGCCGCCCGAAGCAGACCTGCTCTCA
AACTCTACGGCACTGCCACCGCGGCCGGCGCAGACTCAAAGTCTCGGCAGCAGCAACGGCAGCAGTGCCAAGACTTCGTC
GCGGCCAACACCGACACCGCGACCGGTACAATCAGTCCGAACAGTCCGCCCAGCCCGCCAGGTGCCAGTGATCAACGGGT
TGGTGCTCAAGGCATCGTCCCAGCACCGGTCAGCGGGAGCGGCGCACTTTAAGCGCGGCGATTATGCGGCAGCACACGCG
TCATACACGGCGTCACTGGTGGACATCCCGCGGACGCACCCGCTGCTGGCGGTGTTGTACTGCAACCGGGCACTGACGGC
GCTGAAGACGGGCGAGCCGCGACAGGCGGTGGCCGACGCGGACGCAGCGCTGGCGGTGATTGGGCCGGGTAAGGGCGAGG
GTGAGTCAGTAGCGCTGGAGGATGGCACGGGCGAAATGCGCGATCTGCGAGACCTATACGGCAAGGCGATGACGCGCAAG
GCCGAGGCGCTGGAGCAGATGGAAAAGTGGGCAGACGCGGCCGTCGTGTGGCAGCAGTGCGTGGAGGACGGCGTGGGCGG
TCCGACGGCGATTGCCGGCCGGCAGCGGTGCCAAAAAGCACTGGCGCCGAAAGAACGAAAGCAGTCGTCGGAGTGGCAGA
ACGATCCTCTACGGCAGCTACACGGCCACGACCAGCAGCTACAAGATCCTCGGCCCCTACTGGCTACGACTCCGAGGCCG
TGCAGCGGCTGCGGCAGGCTAACAAGGCGGCCGAACGCGAAGACGCAGACAAGCTGGCACTGACAGACCAGGTAGACGCG
CGGGTGGCCCGCTGGCGGGACGGCAAAAAGGACAACCTGCGGGCGCTGCTGGGCAGCATGGACGCGGTGCTGTGGGAGGG
CAGCGGGTGGAACAAGGTCGGCCTGCATGAGCTGGTGATGCCGAACAAGGTCAAGATTGCGTACATGCGGGCGATTGCCA
AGACGCATCCGGATAAGGTGAGTGGTGTAGTGTGGTGTGGTGATAATTGAGGGGGGTGTTAAGTGATTACTAAGACTGAT
TACTCATCTGCATCACAGCTCCCCCAGGACGCGTCGACGGAGGTCCGCATGATTGCCGGGACGGTCTTCAGCACCCTCAA
CGAGAGCTGGGACAAGTTCAAGGCGGACAACAAGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62