GenePrediction:GLEAN_4442 Details

Name: GLEAN_4442
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:828187..823315 (- strand)
Length: 4873
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:828187..827230 (- strand)
Length: 958
Type: CDS
Source: GLEAN
Position: GCSC_161:826878..824945 (- strand)
Length: 1934
Type: CDS
Source: GLEAN
Position: GCSC_161:824442..823315 (- strand)
Length: 1128
>GLEAN_4442 class=GenePrediction position=GCSC_161:828187..823315 (- strand)
ATGTCATCAACAGCAGCGGGTGGTGGTGGTGGCTCGTCGCTCAGCATAGGCGTCATCGTGGCCATTGCGGTGGTGGGAAC
GGTGGTGATGGCTGTGGCTGCGGGTGTCCTGTGTGCGTATTTGGCCCATCAGAGGCGCCTGCGGCTGAACGCACGGCAGA
TGCAGCAGACAACGGCACGGCAGTCGTCACAAGTGGCCGTCCAGCAGGGCGGTTTGCCGATCGGCGACCACTCGACCAAG
GCCGCAGCCAGGCAGTACTTCAATACCAGATCAGTAGCAGCCGGTGCCTCATCTGCAGACAGCTGGTCGGTCGAGGCCGA
TAGTGCGTTTGAGGGCACAGGGTTCACGTGGTGGTGGCGATGCCGGTGGCGGCGGTGGCAGCGTCAGCAGGGCCGACAGG
ACCGACAAGGCGGTCCGGAGCATGGCGCAGACGGCGAACTGCCGCTGTTTGGCAGCGGAGACAGCAGTCGAGTGAAGCAG
CCTCGCACACGCAACAAGCTGCAGCGGCCGCGGCCGGCAGCACCCAAGATGGTCTCGTCGTCCAACTTTGCATTTGTGCC
GGTGCCGGTGGAGATGCCGGCCAGAAGCAAGAGGAGCAGCAATGACGGCAGCGGTGGTGATGCCGGAAAAGACGGCGTGT
CGCCCTCCAAACAAATGAGACCTCAGCGACCACCACCACCGCCACCACAGCTGCGCCTCATCACTCACGATCTGGGCTCG
CAGATAGACACCAGCGACGCCGGAGCAGGTGCTGTGCCACACCCGGCGAACGTGTTGGTTGCGACGCAGAGCCAACAGGA
GCTTCAGCAAGGCTACCAGAACTACCAGAACTACCAGAACTACCAGAACTACCAGAACTACCAGAACTACCAGAACTACC
AGAACTACCAGAACTTCGAGCATCATCAAAACACCAAAAACGGACGGCAGTTCGCAGGCACGCCTTACGCTTATGCAGGT
GGTCCACAGCAGCCGGGCGCGCCTTCCCCCAGTCGTCCGATGACGCGTCCGGTCCTTCCGGTTCTGGACATTCCTGGACA
CCATGACTCCGCAGCGAGCAGATTCCAGCGCCAGTCTCAGCCTCAGCCTCAGCCACAGTCACAGTTGCAGCACTGGCAAC
AACTACAACTGCAGCAACAGCTGCAACAACAGCAACAGCAACAGCAACTGCACCTGCAACAACTGCAGCTACTACAGCAG
CAACAGTACCAGCAGTCCCAACGGATGCCAAGCCGGCCGCACCGGTCGCTGCCGCAGAACCTCAACCTGGCAACAGATTC
GGCGTTGTCTGAGATCTTGCGGTCAACAGAGAAGCGGCTGCAGCAGCTGCAAGCACAGGCGCAGACGGAGCAGCCGGCAT
CCACGGCTGGGTACACGGGCGACGACGATGACGACGTGTTTGCGGCGGTGCCGACGCTCGCGCGCCAGCGGCAGCAGTGC
CTGGCCGAGGAGGCAGCGGCACGAGAGGCAGCAGCTGCTGCTTCTGCGATGGCGATGACGGTAGAAGAGGCCCTGGTGGT
GCCAGAGGCGCAGAAGAGTCAGCGCAGCTCGCAGGAGTCAGGCGTGTCGGAGGCCGACAGCATGTTTGTAGAGGAGGCCA
CAACGACGGCGCTGTCGAGTCCCAGCCGCAGTCCAACCCGGACAACCGATCAGAGCAGCACGATCAGTGTGGCCGCGAAG
CCGCCGACGATGCATCTGGTGCCGAGAGCAGATACAGCCGAACTGGTCAAGACGGCAGAGCACGAAGCGGCAGACGCGAG
CACGTCGCCCGACTCGGGGTCGTCCTCTGCGTACTCGCCACTCTCAACACGATCCTCGCTGTCGACGGTGTACAGCGCAG
ATGAGCGGCCCGAGGCAGCCAAGAAGGCGGCCGGACTGGGGATCACGATGAACAGACGGAGCGTGTTGATGCAGCTGCCG
GTGTGGCAGCAGCAACAACAGTATCTGAAGCAGCAACAGCAGCAGAAGCAGAAGGAGCAGAAGCAGCAGAAGCAGAAGCA
GAAGCCGCAGGGTGTCCAGATCAACAACGGGATTCGGGGCTCGTTTGGAGGCGCTGTGGCGCCGATTCTGGTGGCTCCGG
CTGCCGTCCGGGCTCGGTCTGCATCGTCTGCGTCGGTCACAGCACCACTGCTGCTACAGCCCAGTCGGAGCTCGAATCCG
GCTGCGCCATCGTCGGCGATCCGCGTGCTCGTGACGAGCCCGACGGCCAACAGCCTGACTGGATCGTCATCGTCATCGCC
GGGTAAGCGTGGAAACGTTACGTTGGACGTGACCGACAGAACGGACACAGCTCACGTGCAAATTGGCGAAAATGCATCGG
CCACGGCAGCGGCCGAAGAAGAGATTCGACGACAGCAGCAGCAGCAACAACAACAACAGCAGCGCCGACAGAGCCTGGTG
CCGCCTCCGACGAACCTGGCCAGTCTCGTGGAGGTGTTGGCCGACGTGCCGGAGAACGGCGAAGCGGTCGGGGCCGGGCG
GCGCTGGTCGACACGGCCGTTGCCAGTGGCACCATCTCGACTGTCGGCAGCATCGCTGAAGCAGCAGCAGCAGCAAGAGG
TCGAGACGGACAACCGGGCATCAACGCTGACGACCAACAGCCTGCTGGCGACGGCGGTCGAGCTGCGGCGCATGAACAGC
GTCGCCCACAGCGAAGCCTCGACGGTGTACAGCGAGGCCACGAACATATCGCCGCTGCCACCGCAGATGGCCGTGTTTCC
GGGCAGCAGCACGACAGCCGACACAAAAGACGAAAAGGCCACGACACCATTGCGACGTGGTCGTCGCAGCCGCGTGCTCG
AGGGAACGGCCGCCAGCAAACGCGGCAGCCGTGCCAGCGGTACCGGCAGCCGGCACTACCTCTCGCTCGGGGGGGCTGCC
GGCTCTGGGACGAATGCAGGCAGCAGCAGCAGCGACAAAGAAAACGGCACCGAAGAAAGCGTGGTGGAGGGCGGACCTGC
CGTCTCAATGCAGACGACTTCTGGATCCAAGCGGCAACAGCCACGACCATTCTCCATTGTCGCGGGCCAGGAATCGGCTG
AGCTCGCGTCTCTGTCGACACCTAGACGCACGCCCAGCCGGTCGCCGTCCAAGACGGACAGATCGACGTCCAGCTGCGTT
GTCGTCAGCAGCAACAGCGCCGTCAAGACGCCGGGCAGCCGGTCTCCCACCAAGAACAAGTCGGCCCGTCGGACGTCGGC
GTCACAGGGAACGCCGACACGCACACCGACACAGTCGAGTCCGGTACAGAGAGGCAGTTTGGGGCTGTATGACCCAGACG
GGTTTCTAATATATAGCAGTACATAGCCACTTTTGCGATCTTTGAGTTTTGCTGAAGGATGGCGTTTTGTTCGTAATGGG
TCATGTTGTATTATTTTGTGTATCATACTGAACAGATAGTGTTGCTTTATTTATTTTTGACGTGTGTACTGCACAATGAT
CGTGGCATTGTTTGTTGACGTACCATCGAATAAATATTGGATTGCATACGACAAAGACAGATGTTCTCGAGTAGCCAGGC
CGTTTCGAATTATTTAGCCTAGATCATTTAGACCCCTCATGTGCGTTTTCGCTCCTGCCTAACTTGACAGTAAACCGTGC
AGTTGCTGTTTCGGGCGTTTCTGTCTAAGAGGTATTAAGCTCTTTCCGTCTCGTTCTTCTATTTCTTCTGCCGTATCCCA
TCTCTTTGCCTCTCTCTCCGCTTTCTCCCCTCATCTTATCTCCCATCTAATTTTCAACCAAGCAGCCAACCGCGGCCATG
GCCCCCCTTCCCATCGCCGGCGGCCCCAAGGTGGTCCTTTATCACCAGACGCACCACACGCCGACGGGCGAGCCAGTGTC
GGTGTTGCCGCTGCTGCGTCGCGATGGCGACATGGGACCGTCGGTCACTCACGTGATCGTTGGTGCGATTCACCTGAATG
CCGATCCGGCGGCACCCACGCTCAACGACCACCACCCAGACGACAGCCGGTTTGACATGCTGTGGGCCGAGGTGGGTGCC
CTGCAGCAGGCGGGCGTGCGTGTGCTGGGTATGCTGGGCGGTGCCGCCAAGGGCAGCTACGCGCGACTGGATGTAGGCCT
GCTGGAAGGCCATTCTGCTGCTTCCGCGACGTCGGCCTCGTTTGAGGCCTACTACGCCGCGCTACACAGGCTCGTGCGGC
GACAGCGGCTGGATGGGATTGACCTCGACGTGGAGGAGCCCATGTCGCTGGCCGGCATCGTGCACCTGATCGACCGGCTG
CGTCGTGACTTTGGGCCCGGCTTCCTCATCACGATGGCCCCTGTGGCGGCCTCGCTGCTCCGGCCGACCGAGCCGCGCTG
CAACCTCTCGGGCTTCTCGTACGCCGACGTCGAGCAGCGGCGCGGCCGCGACGTCGCCTGGTATCACGCGCAATTCTACT
GCGGCTGGGGCGACGCGTCCTCGCCCGACATATACCTCGCCATGACCCGTGGCGCCGTTGCGCCCATTTCTGGCCTCGGA
CCCCATCGCGTCGTCATGGGCCTCCTCACCAACCCGGCCAACGGCCCCGGCTGGGTCGACCTCGACATCTCCACCACCGT
CCTCCTCGACCTCTGCGCCGCCGCCCAGACCGACGCCTCCTACTTCGCCGGCGTCTCCGGCTGGGAGTACTTCAATGCCT
TGCCCGGCGCCCAGGCTCGCCCGTGGGAGTGGGCCGAGTGGATGTCTGCTATCCTCGGCAGTTCCGTCGAGGCTGCCAAC
GGCTTCGGCATCCAAGGGGTCGCTGCTGCTGCTGCGGCCGCCATCACGGAAACAGCGCATACAACGGAGGCGGATCCAGA
CGGTGAGGCTGGACTCGAGGCACCAGTACCAGACCCGTTCGAGTACGACTACCAATCCGACACGGAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62