GenePrediction:GLEAN_4444 Details

Name: GLEAN_4444
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:811348..809845 (- strand)
Length: 1504
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:811348..811269 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_161:811175..811162 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_161:810910..810781 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_161:810713..810382 (- strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_161:810323..809845 (- strand)
Length: 479
>GLEAN_4444 class=GenePrediction position=GCSC_161:811348..809845 (- strand)
ATGGCGGAACCAATGGACGTCGTCAAGGCGGAGGAGCAGTTCAAGACGATGGAGCACTCTGAGCAGCATTACTTTAACAG
GTAAGAGGGGGCGCGCTGGCTTGTTCCGGAGTGCTTTTGGATATCCATGGACCTCTTATTATCTTCTTCAATCTGCTAAT
ACTGCCTGTACAGCTACAACCACCATGGTATGTCGTCCTTCCGCATTCGTTGATACCCAAGTGCGCCCGAAAAGAGTCGA
TCAGAAGTGAAGAGGCAGGCTCGAAGGGACTACTGAGAGTGGCCAGAGGAAATCACCCTGCCAATTCAAACCAAGGATGA
TGCTACTTGTGGCCAGGCGGCGATCCAAGTCGAGGGGACTTACCCCGCCAAGCGGCGCAAGAAATAAGACGAGGCTGTCA
TGGAAATAGCACGATTTACTGACCTTCTTCGCGTGTAGGCATTCACGAGGAGATGTTGAAGGACGAGGTTCGGACAAGGT
CGTACATGAACGCTATTGTCCAGAACAAGCATCTGTTCAAGGACAAGGTCGTTCTTGATGTCGGTTGCGGCACGGCCATC
CTGTCGATGTGAGTTTGACGGCCGACGGAGCCAACACATTGGCGAACGAGCCTTGCTGACTCGCATGTTCTCCAGGTTCG
CTGTCAAGGCTGGCGCAAAGCACGTTATTGGCGTGGACATGTCTACGATCATCTTCAAGGCACGGGAGATTGTCAAGGTC
AACGGCATGTCGGACAAGATTACGCTGATCCAGGGCAAGATGGAGGAGGTCAAGCTGCCGTTCGACAAGGTTGACATTAT
CATCTCGGAGTGGATGGGCTACTTCCTTCTGTACGAGAGCATGCTGGACACGGTGCTATACGCCCGCGACCGGTACCTGA
ACCCGGACGGTCTCATCTTCCCGGACAAGGCGACGATCTTTGTGGCTGGCATCGAGGACGGCGAGTACAAGGACGAGAAG
ATTGGCTGTAAGTGTGGCCGGCGTGTCTGGTGTTGGTATCGTAATGTGTGGCTAACATGCTATAGTCTGGGACAACGTGT
ACGGGTTTGACTACAAGCCGCTCAAGGAGACGGCTCTGTCGGAGCCGCTGGTCGACACGGTGGAGCTCAAGGCGGTGGTG
ACGGACCCGACGCCGGTGCTGACGCTGGACCTGTACAAGTGCAAGACGGAGGACCTGGCGTTTAGCGTGCCGTTTGGTCT
GCACTGCAAGCGGGACGACTTTATCCACGCGCTGGTGGCGTGGTTCGACATTGAGTTTTCGGCCTGCCACAAGCCGGTGC
GGTTCTCGACGGGTCCGCACACCAAGTACACGCACTGGAAGCAGACGGTGTTTTACCTGAAGGACACGCTGGCGGTGCAG
CAGGGCGAGGAGGTGCAGTGCTCGCTGAGCAACCGGCCGAACGACAAGAACCGTCGCGACCTGGACATCAAGATCGAGTA
CAAGCTGGAGACGACGGACGTGACACGGGCGGCACAGGGCGAGTGCTCATACAAGATGTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62