GenePrediction:GLEAN_4447 Details

Name: GLEAN_4447
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:782788..781284 (- strand)
Length: 1505
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:782788..782570 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_161:782513..782214 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_161:782146..782032 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_161:781967..781901 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_161:781827..781284 (- strand)
Length: 544
>GLEAN_4447 class=GenePrediction position=GCSC_161:782788..781284 (- strand)
ATGTCGAACACGAAATGTCCTCTAGGTGACTTTGGGCCTGCGCCCGACGGCCTCGATTTGTGTGCAAACAAAAACGCCAC
CATCATCGGACCCGTGGTGGTGGTGTTGGTCATCAGCTTCGGAGCTGTCGCTGTGCGCATCAGCTGTCGCTATTCCATAG
CTCGAAAAAATTCCCGCGGCTTTCTGGCAGTGGATGACTACCTTGTGATCGCTGCGCTGGTAAGGCCTGGTTCGACAGAA
CTAACGCGGAACGCAGGGCTAACACCCTTTCCTAGATCATGGCTGTCAGCATGGGCATCTGCTGCTTCATCGGCGTGCAA
TTCGGAGGCGGACAGCACCTCTGGGCGATAACTGTCAGCAAGTTCGACGACCTGTGGAAGACGCTCTTCGCTTTCATTCT
CATCTACGTCGCCGGCGTCTCCCTGACCAAAGCCTCCATCATGCTCTTTTACCGCCGCCTCTTTGGTTCCAGCACTGCTT
GGTGGGTCGTCTTTACCCTGATTGGGGGTTATTTTGTCGCCATCACGGTGACAGCCCTGGCTGCTTGTCAACCGCTGTCG
TATTTCTGGGGAAAGGTCCGTGATGTTCTTGTCTCCAATTCTTCTGACTCGTGTCCTGACTGCTCTTCTCTTTCCCCTAC
AGTACACAGATCCCAACGCAACCGGCTCCTGCATCGATACCCCGAAGTTTTTCCTCATTAACGGCATCTGCGCCATGCTG
ATAGACGTCTTGATCCTCGTTGTTCCGCTGCCAACCAGTACGTTCATTCGGCCGAATCGTGGTAGCCCCATACCATCCAG
TCGATCTCTAATACCCAATAGTTTACGGTCTCAACATGCCTCCTGGAAAGAAGGCCATGGTGTCTGGTATCCTGCTGCTA
GGTTCTTTGTGAGTCCCCTGCAACTGTGTCTTTCTGACTTCCAATTAGGAAACTAACTCTATCAAGTGTCTGTGTCGCCA
GTGTTGTCCGCATCATTGCACTAGATCACTTCACAAAGGACGAAGATGTCGTCTGGGCCATGGCTGAGGTGTTTGTGTGG
TCTTGCTGCGAGCCTTGCGTTGGCATTGTCTGTGCATGTCTCCCGACCTACGGGCCCCTATTTGCCCGCTTCAAGTGGTT
TCGCCAAGTATCATACAAGGCAAGCTTTCCGCCAACAGGGAAGGGAGCTGAGCGCTCCAACGTCTTGATAACCATTGGCG
GCTCACGCCAGCCCGCAACAACCGGGAACGTTACCACCAAGAGCAGTGGATGGAGTCGTTTGACTAGGGGAAACGACACC
AGCAAGCAGTCGAGCGTTTTCCGCTCTCGTCCCGACGAAGATGAAGTCGAGCTCACTACAAACATACAGGGCAGCAAGAG
ACCCGAACGTGACGCATACGGAGCACATGTCGACGAAATTGCGCGCTCCACAACGCAAGCCAGCGACAGTGACGGGGACG
AGCAGAAGAATATGCAAGTTCTCGTAAAAACGGATGTACGTTGGGAGGTCGAGTCCAGAAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62