GenePrediction:GLEAN_4449 Details

Name: GLEAN_4449
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:762196..759551 (- strand)
Length: 2646
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:762196..762133 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_161:761928..761704 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_161:761606..761517 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_161:761407..760481 (- strand)
Length: 927
Type: CDS
Source: GLEAN
Position: GCSC_161:760412..759975 (- strand)
Length: 438
Type: CDS
Source: GLEAN
Position: GCSC_161:759918..759551 (- strand)
Length: 368
>GLEAN_4449 class=GenePrediction position=GCSC_161:762196..759551 (- strand)
ATGTACTCCGCACAACCAAACGGCGCTGACAGTGCAACGATCAATCCTGCTGCGCTTGCATCCGGTAAGTCGTCGCTCCC
TGCTTTTGCTCTGCGGTCGGAATTTCCGGCCTGCTGTCGGCTTGCGTCCCTCTGCTGCGGCATCACTCTGGAGCTCCCCT
CATTGCGGCCATCCCCCCCCCCTCTCCAGCGCCGTGCCATTCTTTTTTCTTGCATCCATCCCCCTTCGCGTCCCCTGCCC
ACACCCTTCCCTGCATCTTTGCCTCGAGACAAGCGCAGCGCGGCACCAGCAGCAAGAGGCTGCTACAGGCATTCATCGCG
CTACGGCATCGGAATGCACCAGCAGCCGCGCACATTCCTGGTCGCGTCGGCAGTGCACAGCTCCGACGTGTTGCGCCCGT
GCAATCACGACGCTGTCACCCTCTTGCCACTGACCATGATTCCTTCCCGTCGCGTCCTGCCTACGTCAAATGCTTCTGCT
GCCGGGGGAGGAAGTGTGTACTGTCGCTAGAGCATTCCCTTGAAATGGCCCTCTGGTCCAACCTATCTTTCATGTGCTCT
GCCCCAATACTAACAACACTCCGTGGTCAGATCTCGCGAACGCCTCGCGGGGAATCAAGAGGAGCCGGTCTCCAGAAGCG
TATCAGGACGTCAGCCAACAGGGGACGCCTGGAGATGATGGTGCGTTCTTTTCTTTTTTTGCCGTTCTTCCCCCTTCGCA
TCGGAAAAGCAATAATGCTACACCACGCCTCCATCTGACAACAACGCTGACATTCCACCCTTCAAAAAGGTGACAAGCCT
AGGAAACGCGGCCGACCGATGAAACCATCCGCAAAGACTCTTGGAGGCGTCACGGAAACCCCGATTCAACCGCCAACCCT
GCCCGCCATGTCTTCGCAGACAAACGCACCTCCGCAGCCACACTCGGCGGCACAACACCCACAACACGCCCAGCCACGCC
GCGCCTACGCGCCGTCCCTCGCCACCCCCGCTGCATTGCCGGTGGCTCCCACATCTGTTGCAGCTCCTCCGCCAACCCCT
CCGACCCAGTCCTCTCCTCCCGTCAAGACCCCGGCGAAGCCTACCCTTAAGGCACTCCCGACCGTGCGCGACCATACCAC
AGACCAGCTAGGCCCCGGCAACGATGAATACCTGCCGCGCGAGACCGACGAAGCCGGCGAGAAGAAGGTCATGCAGAATG
GTCAGCTCCTCGGCGGCCGTGAATACCGCTGCCGGACATTCCTAGTCCCCCAGCGCGGCGACAAACTCTTCATGCTGGCC
ACCGAATGCGCTCGGGTTCTCGGCTACCGCGACTCGTACCTGCTGTTCAACAAGAACCGCTCGCTGTACAAGATCATTGC
CAACCAAGTCGAGAAGGATGATCTCGTCGGCCAGGAGATCCTACCCTTCTCCTACCGATCTCGCCAAATCGCCATCGTCA
CCGCCCGCAGCATGTTCCGCCAGTTTGGCAGCCGTGTCATCGTCGGTGGCCGTCGCGTCCGTGATGATTACTGGGAGACT
AAGGCTCGTAAGCAGGGCTTCACGGAGGCAGACATGGCCGGCGAGAAACGTCCCGGTGGAACCAAGGCTCGTGAGGCCGC
CGCCGAGGCTGCCGCTGCCCAGAATGCTTCCATTGTCGGCCCGGCTCACGGTGAGATTGTCTACGCCAATGCTCCGCAGT
TCAACGCTGCTCCGCCGTCGCAGCTGGTCCAGCCAGGTTCGTTGCTATGGCCATTTTTGAGCTGAACTTCTGATTATATC
CACTGACACCGTACGTGCGCTTAGAGTACAACGACACGAGAAGCCGCGACTATTCAAGCATCCTGAAGACGGCTCCCCGC
CAAGAGATTACCGGCCCTGCGTACCAAGACCGCTCCCAGCCTGCACCCCTTGGCGAGATTCATGCCCAGGCACACCATGC
GGCGGAGTTCAACAGGAGCGTGAACCAACAGCGCGACATTCGGTCGGACTACATGCAGAACGTGTGGCGCCGCCCGCATG
AGCAGCCGCCTCCGCCGCCAAGCTTGACCCAGCAGCAAATTGTCACGAGCGAGCCACCGCTTCAGTCCGGCCGCGGGGGC
ACGTCCCATGCGAATGCGACTGCCTCGGCCAGCGGCATGCAGCAGCCGACTTTGGTTTCGCACCAGAGCCCTCAGATGAT
GATGACGGCACCGCCGTACTCGCAGTCGATCCCAACAAGCTCGTTGCCATCGTCCATACAGAGTATGCATACGCCCGCGG
CAGTAACATGTAGACTGGGTTGCTAACACGGGTTGAAGGATCTTCAGGCAGCATGTCCCAGCAGGGCTACAGCTATCCGC
CGTCATCACAGATGTGGCCGCCTACACCGCAGACGCCGCAGTCGTCGCAGTATAACTACAGCCATCATACGCCTGTGCAG
CCATCGCACCCGCAACAGCCGCCGCCACAGCTGCGGCACCCAAGCAGCGGTGCTCCCGTTCAGCAAGGCAGCCTGCCGTA
CTCTGGAATGCCCGGCATGAGTCCCGGCTATCCGTCTCAGAATCAGCCTATGCCGTATGACCAGACGCCTAGGCAATACA
TGCATCAGCCGGGCTCTGGCTCGCCAGCCGTTACTCAAGGCTGGTCAGGACAACCCCAGCAGTGGTGGAACAATCAGCAG
CAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62