GenePrediction:GLEAN_4453 Details

Name: GLEAN_4453
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:734238..732145 (- strand)
Length: 2094
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:734238..733852 (- strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_161:733805..733552 (- strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_161:733491..733343 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_161:733288..732934 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_161:732811..732145 (- strand)
Length: 667
>GLEAN_4453 class=GenePrediction position=GCSC_161:734238..732145 (- strand)
ATGGAGGCCGAGTACCCACCAGCCGGTGACATACGCAAGCTCATGGACGAGAACCCTCTACCGCAGCTACCGGCAGCCAC
TGTTGCTGCCGCCACGGCGGCCATTGAGGCCGGAGGACACGAAGCGGTTGATAAGCATGTGGAAGACGCTGTACGGGCGC
TTAACGAAGCGCTCGCAGCTGGAGACACCGCAGCTCTTGCGGCCGTCTTTTTCCAAGAGCAGGCCTTCTTCCGTGACACG
CTGGTTCTGACGTACGACACCCGCACATTCATATCGCCGCATCTAGCAGCGGCTGCATTGCTCGAGACAACTCGGCTGCG
CCAGATGTCACCAGCCTGCTTTACCGTTCAGCGTCCGGCCGTTTATCTCCAGGTGCTGCCAGGCCTCGTGAGTAGCTCCG
TGACTCTGTCTCTACGCCCTTTCTGACAGACAGGTATTCATTGATGCGTCGTTGACTTTCCACACCGACGCGCCGGGGGC
TACCGGCAGTGGTCGTGTGCTGCTCGTGCCTGTACTTACAGCTTCCAGCAACGTTGTCGCGTGGAAGATCTGGATCTTGA
GCACACAGCTCGACAGCTTCGACGCCTTCTGCATGGACGAGAGCAGACTCACTAAGCCACTAGTAGATCCTGTGCAGAGT
GAGGGTCCCATCGAAACGGACGTCATTATTATTGGTGGCGGAAATGCGTGAGTCTGCCTTGGATGAGTCTATGCATTTGC
ACAGCAGCTGAAACAACTGTCTTTTAGCGGAGTCGCTCTGGGCTCCCGCCTCAAAGCGCTCGATGTGCGCCATCTCATCG
TCGAGAAAAATGCACAACCGGGCGACAACTGGGCCAAGCGGTACGACAACGTGCACTTTCACACGCCAACATCGCTTTCC
TCGATGCCCTACATCGGTACGTCCTACCTGTCATTGCGATGTGTATGTGCTGGCTAACTCGCGGACGCAGACTACGACAA
GGAACTGCAAAGTCCTCATCTGCTGACGCGCGACGAGCTGGCAAGCCAGGTAAAGCGCTTTGTGCAAACAATCCCTCTGA
ACATCTTGTACCAGACCACAGTACGGTCCACCCGTCTCGACAGCCGCACTGGCCAGTGGACGGTGATCTTGAGCACGGCC
GGTGGAAAGACGCGGACCTTGGTGGCGAAGCACCTGGTTCAGGCAACTGGCCTGGGATCACAGGTGCCGAACAAGCCGAA
GATCAAGGTAGAGGCGCCCTTTTCCGGAGCAGACCTCCACTCGGCCACCTTTAAGAACGCCAGCGAACTGCACGCCCGTG
GCGTCCGTTCTGTCGCTGTCATCGGGTCTGCCAACACCGCCTTTGACGTGCTTGAGGACTGCGTGGATGCTGGCCTGACG
GCTACCATGGTTGTACGCTCCCCGACGGTAATGTTGTTCCGGTCGAGCACATTTGCAACCCGCACAGCCTAGGCATCTAC
GATGTGATCGGCGTGGCTGCCGGTGATCGGATGTCCCTGACACTTCCGTCCTTTGTCGACGGACACATGAGCCAGAGACT
GTTCGCACAGCTGGCCTCTGCCGAGCCCAACCGCTATGCAAAGCTCGCCACTGCCGGCTTTCCCGTCATCGACAGCTGCG
ATGCTAACGCGTCGCTGATGCACCACGTGCTCGAGCGTGCCGGCGGTCACTATATTGATATCGGCGGCACGAAGCTGCTG
GCCGACGGCCGTGCTGCCGTGCGTGCCCGCGTCGAACCTGTTGCCTATACTTCCACTGGGCTGCGCTTGTCTGACGGCAG
CATGCTTGATGTAGACGCCATTGTGTGGTGCACAGGCTTCGCTGACAGGGATGTCCGCTGCGTTGCCGAGTCTATCTTGG
GAGGAGATGTCACTGACGATGTCGCCGACGAGCCTTACATCCTCGGTCCATCTGCCATTGCAGCTCGTCTAGACGCCATA
TGGGGCGTGGATGCCGAGGGCGAGATCCGGGGAATTTGGAAGCGTCATAGCCGTCTGCCAACATACTGGTTTATGGGTGG
CCAGACGCAGCAACATCGGGCCTTCTCGCGCACTTTAGCACTGCAGCTCAAGGCCGCTCTTTCCGGCATCCTTCCCCTTG
CCTATCGAGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62