GenePrediction:GLEAN_4457 Details

Name: GLEAN_4457
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:708354..705801 (- strand)
Length: 2554
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:708354..707415 (- strand)
Length: 940
Type: CDS
Source: GLEAN
Position: GCSC_161:707134..707061 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_161:706574..705801 (- strand)
Length: 774
>GLEAN_4457 class=GenePrediction position=GCSC_161:708354..705801 (- strand)
ATGCAAGCCTTTAGATTCAACGACGTCTCGACCGGGCTTCAGCTCCTAGACGTGCCCATCCCAGAGCCAGGCCCAGGACA
GGTGCTCGTTGCTGTCAAGGCAGCCGGCCTGTGCCACTCGGACGTCCACGTCCTCCAGGGTGGCGGCCAGGAGTGGGAGT
CGACCAAGCCGCTGACCCTGGGCCACGAGGTGGCCGGCACCATTGTCAAGCTGGGGCCGTCCAGCTCAGACTCGCCCTCG
GGCTCGCCCTTTTCTGTCGGTGATCGCGTTGCCGTCGCCCAGATCTGCCAGCCGACCGACGCCATGGACTGGACCAAGGC
CGTCGGTGTCGGCTTCGACGGCGGTTATGCCCCCTATGCCCTCGCCTATGTCGACCATCTGTGTGCCATCCCGGACGGCG
TCAGCTTTGCCCAGGCTGCCGTGGCCACCGACTCGATCGCGACTGCGTACCACGCCGTCGTCGCCTCGGCCGCCGTCCAG
CCGGGCTCGAACGTCGCCATCCTCGGCCTCGGCGGCCTTGGAACCAATGCTGTCGCCGTCGCTGCTCATCTCGGCGCCCA
CGTCTATGGCGTCGACGTCAATCCCGACAGCTATGGCCTCGCCACGCGCCTCGGCGCCGTCGCCTGTGCCGCCTCCATCG
ACGCATTCCAGCACGTGACCCTCGACGCCGTCATCGACTTTGTCGGCCTGCCCGCCACCGTCAAGGCCGCTGTCACGGCC
GTCCGCATCGGCGGCACCGTCGCGCTTGTCGGACTTGGCGCCTCCAACGTCGAGATCCCTTTCGCCATCGTCATCCTGCA
TGCCGTCAACATCGTCGGGTCCATCGGCGCCTCGCTCGACGATCTGCACAAGGTCTTCGCCCTCATCGAGTCCGGCCAGC
TAAAGCCAAACATCTCTGAGATCCCCTTTGCCGACATCCCCAAAGGCTTGGACGATCTCGGTAAGGGCACGGTGTCAAAC
CGGCTGTATGCTTGCCCAACTCTGTAAATGGTTTTTCGTCTAGACCACTTGGACTGGCACATGTAACAATAGCAAAATTT
GTGTATTTAGGTGTAGTTTCATTAGTATTTTTAATGTTTTTCTATTCCGTGGTATAAAAAGTGAAAGTACATTCTTAGGA
GATCACACTTTAGCTGTACAAAAGGGATTAAATACAGGTTATAAAGACACTAGCTCCTTATGTCTGCCTCCCGATCTCTA
ATGACAATCGCCACGACTAGCCTTCAAGTACTCGCCAATCCCGGCCCGAGTTAATAGTCTGTGGTTGGCGACTCTGACGA
CGACGCTGAAAGCGGTGCTCAGTCATGCTGTTAAATAGTAATATAATCGTGGCAGCTTTAAGTTAATGAGAGCTTTGTGC
TGCCTCTGTGACTCGAGTGATGTTAAAATAAGATTTAGTCGTAAATGTACTTTTGCAACAGATGCAGGGGTATGGAGTAT
TGAACTTTCACCACTTTCATGGGAATTGGCATTATGGATCTGTTTGTTTCAGTACACTATGTATTCCGTACGAAGAAGAA
GGTTTATCTACCACATATGAGTAAGGATGTCATTGGCTTCCAAACAACTCGAGCCTTCTTTGACTGAACCTCGTCTTTCG
TTCCTTACTCCCGTACTTTACAATACTATTTCTTACATTTGCATACGTCGTATGACACAAACCTACCGATTATTGTTAGT
GTTTGCTTGACTAAACATTATTAGTCATGGATGTGGGGCATTGTTGCCTGCAGTAGCTTCTTCACCTAAAAGCTGCTTCT
TCCAACGAACAACCCTACAGGCATACAAGCAGACACGAGACACGAGACACGAGACACGAGACACGAGACCCGAGACCCGT
CGCCTCAGCCACCCAGCGCCCGTGCCCATCATGTCGGCCGAGATGCTGCCCATCAGCCCAGCGCGCTTCGCCGAGGCCAT
TCAGGACCTGCCGCTGTCCAGCCTGCACCTCAAGGTGCTCGAGATCCGCAACGACATTGCCCACCTCGACTACTCCAACG
AGCAGCTGCTGCCGTACGCCCAGGGCCACGCGGCCGTCCTCGATGCCGGCGCCGCCACCGCTGCCGACGTGCGCGCCCAG
GAGTTCGCCCAGCCCGACCAGGACTGCATCGACGCCATCCGCGAGAACCAGGGCGTCATCGAGCGCAAGCTGGAACAGAT
CCGGCTGGTGCGCGTCGAGGTCGAGAAGCGCGGCGCCAGCTGGTCCGAGCTCCTCGGCAAGGAGGAGGTTGAGCTACAGC
AGGCCGAGGCCCGGCGGCGCGCAGAGACGGCCGCCTCGGCCCTGACAGCTGCCCAGGCGGCCGCCACAAACGGCACAAAT
GGAACGGCGGCCCAGACCAACGGGTCCGACCCCTGGTCCGACGGCACCTTCTTGACCGGCACCATACGCAACGGCGTGCT
GCAGATGGCTCCGCCAGGACGGCCACAGGCACCGCAGACTTTGGAGACATCGCAGACGGGCGGCCGTCTGACAGACGAGC
AGCTGCGCAGCGCCCTCGAGCAGCAGCTGCGCCTCGACGAGAACGACCAGGACGACATTGGCATGCACCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62