GenePrediction:GLEAN_4458 Details

Name: GLEAN_4458
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:704875..704148 (- strand)
Length: 728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:704875..704351 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_161:704300..704148 (- strand)
Length: 153
>GLEAN_4458 class=GenePrediction position=GCSC_161:704875..704148 (- strand)
ATGGGCAGCATCGAGATTCCTTACTGGCAGGTCAACGTGCCACCGGAGCAGTGCACGGTCACCTGCCCCGACTTTCTGCG
CGGCATCAGCGCCCGAGACGTGGAGATCATCAGTACGCCCTCAGCCGCCTGTCACACCCTCAGCTGGGACGAGGCGCGGA
CCATTGTGGCGGCCGGCCGGCTCGACCAGTTCCAGCGGTCACCCACGCAACTGCGCAGCTACCTCGCGTACGCCTGGGGA
CTGCGCCAACAGTACGGCAGTCCCGTCAGCTATCTGCTCCAAGAACGCTTGCGATGGCGCGCCGACGAGCCTGCACAAGG
CGCCGCACCGTTTGTCTGCCCGTCTGACGTCAAGGTCATGTGCAACGACTGGCCGTACGGTATCGACGACCGCATCGTCC
ACCTGGTCGTGTGGACCAAGTTTGCGCTCGAGGAAAACCCAGTGACGGACAAGCTGGCGGACGAGACACGCACTGCCATC
GATCGGTACGTCAACAAGACGTTTGGCGAACTGCCCAAAGATAGCGTGAGTTTCTCCTGCGCCTCGCTTCCGTCTTCCTC
TCCTGACACCTCCAGTATATCTGGTTCAAAAACTGGCGGTCCCTCAAGTCCATCCTCCAGATCGAGCACTTTCACGTAAT
GTTGTTTGATCCGCCACAGGAATTTGTCGACAGGGTCACAGACGGAGATGTGCCGCAGTTTAGGCGGGCAGCTAAGGACG
GTCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62