GenePrediction:GLEAN_4459 Details

Name: GLEAN_4459
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:695687..692003 (- strand)
Length: 3685
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:695687..695582 (- strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_161:695504..695448 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_161:694666..694380 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_161:694323..694123 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_161:693711..692578 (- strand)
Length: 1134
Type: CDS
Source: GLEAN
Position: GCSC_161:692328..692152 (- strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_161:692005..692003 (- strand)
Length: 3
>GLEAN_4459 class=GenePrediction position=GCSC_161:695687..692003 (- strand)
ATGACACCATCCGAGACCCAGCAAGTTGACGGCCAGACCGCCGAGAGAGGCGAAGCCTCCCGACCGGAGTTTGCTAGCAC
GGCACCTGCACCTGTCGAGCCTATGAGTATGCGGCCCAGTCCCTGCCATCCTTTGAAGTCAGCGACTGGACAGCCTCAGC
TGACATTGGTGTTTTCCTTTTAGAGCTACAGCCTCCGGAAGAAGAAGAAGAGCCCGTTGTCGGAATGCGCGGCGGTCGCG
GTCAAATGTGTCCCGGTCGTTTCTGTTTCATTATTCCGTGTCCGATACCATGCGACTTCTGCATCATCTAGTCGGGTCCT
TGTCGAGATAGAGAGAGCCGCTTGCCGATGGAAGCTTCTTAGGGACGATATTACAAATATAGCCTCTGTTAGAGCCACTG
GTTTGGGGGGCATGAGTCAATTGTGACGTCTAGTTCTAGATTACTACAAGACTCGTATGTCGCTTTGTCAGTTGTCTCTG
ACATCCTCAGCCTATGTGTTCCTCCGTACAGTGGGAGGACGGTTTAGATGTTGAACATAAATACTCTGGCAGTTGAGTGT
CGAGCTGGCGATGACGTACTCCGAAGAGGCTATGCAGCTAGTAAAACGGTTGACTAAACATTACAGCACTTGAAGGAGCC
CAGAGTGATATCTTAGTGGAAATCGAGTCGACTCTACACGACTACTTAGGCGGGTGCAAACTTAGCAATTGTGTAAAGGC
TCGCAGATTCCTTTCACGGCATACTTCAGCGGATTAACAGATGGCTCGCCACTGTATCTTCGTTCAGAAGAACTCCACAC
GGGATGGCTTGTAGTATATTCTCCGACATTGACAACCAGTATAGGACCATCTCGATACAGCGTTCTCTTATTATCAAGTT
CAATCGACGATATTCGCGGCTGTACTCCGTAGAACCCATAGTATGCACATTGGATGAGAAGCACAAATTAGTGTCACGTG
CCATGGGACCCAAAGTGGAAAGCAGGAGCTAGCTTTGCTTCCACGTTTTCTCTCCTAACAGCTGTCCGTATCCACATGAC
GGCAATCCAGCAGACGACAGACGCGCTCCCAGACCAGACGTACAGCACCGCAGGCAAAGCAATGGCGGTTCCTGTGCGCG
ACGAGCAGGATGTGTCGGACGCGGAGGCAGAGGATGCGGCATTTCTGCGCGAGTCGTACCTCGCATTTGCGGTGCCGCTG
GCGACAGATCGGCGGCTCGAGCAGGCTCTCGAGCAATGCCACGGGTCACCACAGGACCTGATCGAAGCAACGGAGGAGCG
AGAGTCGCTTTTTTTCGGTATGGATGCGGTGTGGCGAGCGGCGAATATAATTTTCCTCCCTCTCGGACGCTTGCTCATTC
GTAGATGCCAGATGAGACGGTCGATGTGTATTTCATCCTGCGCACGCGACACGAGGGCGCAGCTCATCTGCAGTCCTTCC
TCGACCGGTTATCGATCACGCTCGACGCCCACATTGTCAACATCATTCCGGGACGGGAGACGCCACCGCCAGTGGAGGTG
ATTTTCAACGGCAGTGTGGAAGAAGTGCACCGTCCGCTGCTAGTGGTGAGCGACCCGGAGCCGGAGAGTGAGGGGGATGA
AGTCGAGGAGGAAGAGGCGGACGGCGAGGACGAGGGCGAGGACGAAGACGGAAAAGACGGAGAGAACGACAAGGACGAGG
CCAATGATGAAGAGAAAGAAGGAAACAGCGGGACGAAGCGACGACGACGAAAGGCCAAGCAGTCGAAGCAGCGAGCAGAA
CGGCAGACGTTTGTGATCTGGCGGCTGTCAGTGTTTCTGACACGGCCACGGGCGCGACTGCACGCGCCATCGGTGTCGTT
CGCGGTGGCGGCTAGCCTACGTCCAGCGGTGGCAGGTCTTGCACCCCGAGCAGAAGGAACAGGAGACGAGGAGCAGAAGC
TGGCGGCGGGCATCATCAGCAGCAGCAACAACGGCAGCGGCGGCGGGTTTCTACAGAGCCGACAGCCGTGCGGGCTGAAC
CTGCTGGCAGCACTGGCGGGCGACCCGATGCTGCAGCTGGACAGCGAAGGAGGATGGCCACGGCTGTCGGCGCAGCGAGT
ATCGCGGGTAGCGCCGGCAGGGCTAGCGCAGCAGCAGAAGGCCAACCAGCGCAAATGGGCGGGACAGCCACAGCCGCTAC
GCGGACAGGGAGCCACGGTACTGCCGATTGTGCCGGCAGTGCACGCACGGATCCGATTTGTGCGGCCAAGCACGGTGCCG
ACGAGTGCGGCGGTGGTGGGGGTACTGGAGCTGGACTTTACGCCCTTTTTCGACTGCGAGGCAGTGCTGACGCGGGTAGA
GGTGACGGTGCGAGGCGGCGAGGTCGTGGACTTGAACGGGGAGGACGACGGAAACGGAGACGGAAAGGCAGACGAGGCGG
GCAATGCTGACAAAGCCGGACAGGACGGGATGCGGCTGCCGTTGTTCTGCGTGGCACGTGATCACCTGACATTTCTGTAC
CGGCTGTCGCCAGCAGCCTACGGGTTTGACGCAGCCCTCAACACGATTCCGACTCTGACGCCACCGACGTCGCGCGAGCT
AGACATTGCCGTGGAGGCACGGGTGCTGGTGCGGCCAGGCATGTGCGAGCCATCGCTGGCGATGGCGTGGACGACAGCGG
TGGACTTTTCGCTACCAGTGAATCCAGGCTTTGGAACAGCGCTGCCACCGGTGTCGCTGCAGCGGGGAGCACACCGGCCG
TCGCAGTTGTCGATTGACGGGATGGCATCGATGATGGCACCAGCGATTAGCCGGCCGGACGCACTGCCGTCGCTGGAGGC
AGCGGCCCGGAGCACAGAGACGACGATTCCCGACTTTGGCATCACGATGACGCTGACGGCGCCAGACCGGCCAGTCTATG
CGGGCGAGGAGTTCTGCTGGACCGTCTTCATCGTGAACCGGACGGGGGGTTCGGCGTTGCCGGCGCTGCCAGGGCGAGAG
ACGAACGGCCTCAGTCACGGATACGGCCACGGGTCAGCGAACGTGCATTCGGCCTCAGGGTCGGCATCGACCAACACGCC
GGTGCCGGCGACGCCTCCACGACTGCGCAAGCTGGCACTGCTGGTGTTACCGCGACGGCGACGCAACGACGTGCGGGTGA
TGCGGCCGCCGTCGACGTCGGTGTCGGGAGGAACGGTGGCGGGCGGACGGCCGCGCGCGGCGACGAACCGCAGCATGCGC
AGCGTGCACAGCGTGCGGCTGGGCGGTGGTGGCGACGAGGTCGGCGAGCGGGCAGCGTATGCGGCATACGTGGCGGCAAC
GACGTCGACGACGTCGACCATGTCGCCGGAAAAGGTGGCGGACGCAGTGCTGGACGAGAACGTGGTGCATGCGATGCAGC
GCAGCTCGCTGGTCGACGGCACGGACGTGGTCTGCCTCAGCGCAGACACGCGCGTGGGCCCGCTGGCACCACACGCCTGC
CACGTCGTTGAGCTGCGCTTTGTGGCGCTGCGAGCAGGCGCCGTCGGCATCGAGGCCGTCCGGGTGGTCGATCTGGGGTC
GCAGGAACACGTGGACGTGCGGGAGCTGCCGGCGATGATGGTGCTGGAGAGAGAGGAGGGGGACAAGAAAACGACAGAAG
GGTGAGAAGGCGAAGAGAGAGGAGACGTGAACGAGGAGAGGACAAGAGGGGAATCGAGGCAGATTTATGTCTTGATATAC
AGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62