GenePrediction:GLEAN_445 Details

Name: GLEAN_445
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1814600..1817131 (+ strand)
Length: 2532
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1814600..1814691 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_167:1814711..1814964 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_167:1815180..1815747 (+ strand)
Length: 568
Type: CDS
Source: GLEAN
Position: GCSC_167:1816159..1816407 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_167:1816468..1817131 (+ strand)
Length: 664
>GLEAN_445 class=GenePrediction position=GCSC_167:1814600..1817131 (+ strand)
ATGCCCGAGTTTTTTTCCTTTACGCTTGGCGCTGAGACGAACCCGCGTGTGCTGCGCGGACCGGACGAGGAGTCACCGCT
GCTGGTTGGCCGGTTCCGGGCTGTGGTGCAGTCAGACAGCGGACGAGCAGGAAGGGGAGCAGGAAGAGGACGAGCAGGGC
GAAGAGCCGGACGAGCTGGACGAGCTGGACAAGCAGGAGAGAGCAGCCGGGATGGCGGCAACCCACACCAGCCCCATGCC
AGACGGCATCCGCGCTGGCCGTCACGCTGGCCACAGCGCTGGCCGCTTGCAGGGGGACAGATCGGACAGATCAGTCAATA
CGAGCGAGGACGGCCATACGGGGCCGTTTCGACGTCGTGGGGGTCGTGGGAAGCGGCCGAGCAGGAGGACGATGAGGATG
ACGGGTACGATGAAGATGACGAGGACGACGAAGAGGGGGCCGACAGCATCGAAGTGGACGACGACACCTGGACGCTTCCC
GGTGGAAAAGACGCACGACGACCACCACGCCGACGACGACGGGTCCTGCAGCGATGCGGCCGCCACGTGCGGGATGTCTG
GCTGACGCCGCGGCCGGCAGCCGTGCACCGCGTCATGGGCCGCTGGTGGACGCGCTGGGCGCTTCTGGTGGTGCTGCCGG
CCGTCGTGGCGGTGACCTGGTGTGCGGTGCCGATGCCGCAGTGGGCATTGGCCGATGGCGAGAACGGAGGGTTGGGCAGG
AACGGCGAACCGAAAAGACCGCCCGGTCACGGCGAAGCCCGCGTTCGCATCGGCTTCTGGCACTTCCTCCTGGCCTACTA
CGGCCCCTACAACGGCGTCGCGCTCGTCTGGATCACCAAGGTCTTCAACCTCTACGGGCTCAACTGGTGGGCTGACTCGC
TCGGCTTTGTCGCCAGCGCCGTCCTGCTCGCTGCCGCCTCGCTCGCCGCACCTGCCCTGTTCTTTGTCGCCGCTCCCCAG
ACGGCTCGCCGGCTGCTGTCACACAATACCGTCTGGGTCACGTGGACGTTTGCCGTCATGGCCGTACCCGCGGCCGCTGC
CCTCGCCCTGCTGCTGCTGCATGAGCGCCATCTCGGCCTGCGCCACGCCCTCTCGGCCACCCAGCGCATCTTCACGACTG
CCCGCTGGGCCGGCGAGCCGGACGGACAGTCGCCACAGCTCCGGGCCTCGAGACAGAGCCAGAAACAGAATCAGAATCAG
AAGCAAAAACAAACGCAAAAACAGAAACAGAAACAGAAACAGCCACAACAACAAGGCCCCGACAGAGAGCAGGAAGCAAG
ACTGATCAAAACAAACCAGGATAGACAGGCCGACCTCGTCAACAGCTGCGTCCTGCCTCCGTCTTCTGGCTCCTCTCAGT
TCTTCCCGGCCGATAGCCCTCGATCGGGCTCTCCTACAAAGTCTGCCATCATCGCCACCTCTGTCCGTGCCACTTCCTCC
TCTGCCTCTTCCTCTTCCTCCCCCCTTCCCCCCCTCTCTCCCTCCAACTTCTCCTCCCTCGCCCCCCTTCTTCCCCTTCG
TCCTGCCGTCGCGATGCGCCGCTCTTGGCTGCCCGCCAGTTTTGTGCGCTTCCTCTGGCTCGTGAGTGCCCTCTTCATCT
CCTTGCTCGTCTTTGAGCTCGGCGAGGCCTCTGCCTCGCTCTTTCTTTCCGCTCTGCCCGCCATGCGCCACGAAACGGTC
TATGCCGTTGTCTATGTCTGGGGCTGGACCGTGACCGTCTTCCTGCTCGACCTCCTGACCGCCTGGATCCTGGGTGGCCA
TCAAGGCGAACGTGTCGGTAGCTATCCATTGGGATGGGTCTTCAAACTGTGAGAATCCATCCTCTCCTCTTTTTTCCTTT
ACCTTCCTCCCTCTCACTAACCCTCCAGCTACTTCATGCTCACGTACCAAACCTACGTCCGAGCCCTCTACGCCCGCCTC
CGCTCGCCCTCCCAGGTCATCATGCTGCAGGTCCTCTCCTCGTCCACGCTCATCGTCCTGACCCCCGTCCTCATGTCACC
CTGGACCCATCGGCTGCTCGTGGCCCTCGGCCTCAATGGACTCGCCTACGGCGCCTACCAAAAGGTCTGCGCCCGCAATG
TCTTTGTGCGCTTCGTCGCCGAAAACGCCACCATGCTCGCCTTCCTCGGCGCCCTGCTCGTCCTGCACTTCGGCCCCAAT
CGCGACGTCTATCCCTACTTTGGCTTCGACGACGAGCCTGTCAATGCCACCGCCAACGCCTTGGGCAGCCTCCTCGATCG
TTTCGCCAGCCAAACCTACGGCTACACCCCCTCTCTCCCTGACTACCCTGTCCCACCCCCGCCCGCCTACACCTTCTCCT
TCACGCTCTATGCCGCCACCATTACTTGGGCCTGCGAGCTCGTCGCCGCCGTCCTCGTCTCTTCGCTCATCCTCTGCTTC
TACGGCATCGCCGTCGTCGCCGAGGCCAAGGCTGATCTCGCCGCCTGGCCCGAACTGCTCCCTGCCAGTGTCGCCGTCAC
CGTTCATGTCCTGCAGAATATGCTCTTCTCCATCATCCGCCTGCGCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62